필리핀원숭이 RAB7A / Rab-7a Gene ORF cDNA clone expression plasmid, C-HA 태그

    데이터시트리뷰관련제품프로토콜
    필리핀원숭이 RAB7A cDNA 클론 제품 정보
    Gene_bank_ref_id:XM_005571763.1
    cDNA 크기:624bp
    cDNA 설명:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) RAB7A, member RAS oncogene family with C terminal HA tag.
    유전자 동의어:RAB7A
    :Cynomolgus
    벡터:pCMV3-C-HA
    Plasmid:
    제한 사이트:
    태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    필리핀원숭이 RAB7A / Rab-7a Gene ORF cDNA clone expression plasmid, C-HA 태그 on other vectors
    필리핀원숭이 RAB7A / Rab-7a Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그CG90388-ACG265260
    필리핀원숭이 RAB7A / Rab-7a Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그CG90388-ACR265260
    필리핀원숭이 RAB7A / Rab-7a Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그CG90388-ANG265260
    필리핀원숭이 RAB7A / Rab-7a Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그CG90388-ANR265260
    필리핀원숭이 RAB7A / Rab-7a Gene ORF cDNA clone expression plasmid, C-Flag 태그CG90388-CF229890
    필리핀원숭이 RAB7A / Rab-7a Gene ORF cDNA clone expression plasmid, C-His 태그CG90388-CH229890
    필리핀원숭이 RAB7A / Rab-7a Gene ORF cDNA clone expression plasmid, C-Myc 태그CG90388-CM229890
    필리핀원숭이 RAB7A / Rab-7a Gene ORF cDNA clone expression plasmid, C-HA 태그CG90388-CY229890
    필리핀원숭이 RAB7A / Rab-7a Gene ORF cDNA clone in cloning vectorCG90388-G88420
    필리핀원숭이 RAB7A / Rab-7a Gene ORF cDNA clone expression plasmid, N-Flag 태그CG90388-NF229890
    필리핀원숭이 RAB7A / Rab-7a Gene ORF cDNA clone expression plasmid, N-His 태그CG90388-NH229890
    필리핀원숭이 RAB7A / Rab-7a Gene ORF cDNA clone expression plasmid, N-Myc 태그CG90388-NM229890
    필리핀원숭이 RAB7A / Rab-7a Gene ORF cDNA clone expression plasmid, N-HA 태그CG90388-NY229890
    필리핀원숭이 RAB7A / Rab-7a Gene ORF cDNA clone expression plasmidCG90388-UT229890
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    Size / Price
    Cat No: CG90388-CY
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".