RANGAP1 cDNA ORF Clone, Cynomolgus, C-Myc tag

Cat: CG90431-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RANGAP1 Reagents
CRO Services
Product recommended

All RANGAP1 Reagents
RANGAP1 cDNA ORF Clone, Cynomolgus, C-Myc tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1761 bp
Description
Full length Clone DNA of Cynomolgus Ran GTPase activating protein 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RANGAP1 Background Information
Full Name
Ran GTPase activating protein 1

RANGAP1 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
RANGAP1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90431-G
RANGAP1 cDNA ORF Clone, Cynomolgus, untagged CG90431-UT
RANGAP1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90431-ACGLN
RANGAP1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90431-ACG
RANGAP1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90431-ANG
RANGAP1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90431-ACR
RANGAP1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90431-ANR
RANGAP1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90431-CF
RANGAP1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90431-NF
RANGAP1 cDNA ORF Clone, Cynomolgus, C-His tag CG90431-CH
RANGAP1 cDNA ORF Clone, Cynomolgus, N-His tag CG90431-NH
RANGAP1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90431-CY
RANGAP1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90431-NY
RANGAP1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90431-NM

RANGAP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RANGAP1 cDNA ORF Clone in Cloning Vector, Human HG18414-U
RANGAP1 cDNA ORF Clone, Human, untagged HG18414-UT
RANGAP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18414-ACGLN
RANGAP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG18414-ACG
RANGAP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG18414-ANG
RANGAP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG18414-ACR
RANGAP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG18414-ANR
RANGAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18414-CF
RANGAP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18414-NF
RANGAP1 cDNA ORF Clone, Human, C-His tag HG18414-CH
RANGAP1 cDNA ORF Clone, Human, N-His tag HG18414-NH
RANGAP1 cDNA ORF Clone, Human, C-HA tag HG18414-CY
RANGAP1 cDNA ORF Clone, Human, N-HA tag HG18414-NY
RANGAP1 cDNA ORF Clone, Human, C-Myc tag HG18414-CM
RANGAP1 cDNA ORF Clone, Human, N-Myc tag HG18414-NM
info info
添加购物车成功! 添加购物车失败!