RBBP7 cDNA ORF Clone, Rhesus, untagged

Cat: CG90722-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RBBP7 Reagents
CRO Services
Product recommended

All RBBP7 Reagents
RBBP7 cDNA ORF Clone, Rhesus, untagged General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1278 bp
Description
Full length Clone DNA of Rhesus retinoblastoma binding protein 7.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RBBP7 Background Information
Full Name
retinoblastoma binding protein 7

RBBP7 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
RBBP7 cDNA ORF Clone in Cloning Vector, Rhesus CG90722-G
RBBP7 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90722-ACGLN
RBBP7 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90722-ACG
RBBP7 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90722-ANG
RBBP7 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90722-ACR
RBBP7 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90722-ANR
RBBP7 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90722-CF
RBBP7 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90722-NF
RBBP7 cDNA ORF Clone, Rhesus, C-His tag CG90722-CH
RBBP7 cDNA ORF Clone, Rhesus, N-His tag CG90722-NH
RBBP7 cDNA ORF Clone, Rhesus, C-HA tag CG90722-CY
RBBP7 cDNA ORF Clone, Rhesus, N-HA tag CG90722-NY
RBBP7 cDNA ORF Clone, Rhesus, C-Myc tag CG90722-CM
RBBP7 cDNA ORF Clone, Rhesus, N-Myc tag CG90722-NM

RBBP7 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RBBP7 cDNA ORF Clone in Cloning Vector, Rat RG80858-U
RBBP7 cDNA ORF Clone, Rat, untagged RG80858-UT
RBBP7 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80858-ACG
RBBP7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80858-ACGLN
RBBP7 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80858-ANG
RBBP7 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80858-ACR
RBBP7 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80858-ANR
RBBP7 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80858-CF
RBBP7 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80858-NF
RBBP7 cDNA ORF Clone, Rat, C-His tag RG80858-CH
RBBP7 cDNA ORF Clone, Rat, N-His tag RG80858-NH
RBBP7 cDNA ORF Clone, Rat, C-HA tag RG80858-CY
RBBP7 cDNA ORF Clone, Rat, N-HA tag RG80858-NY
RBBP7 cDNA ORF Clone, Rat, C-Myc tag RG80858-CM
RBBP7 cDNA ORF Clone, Rat, N-Myc tag RG80858-NM
RBBP7 qPCR Primer Pairs, Rat RP300822

RBBP7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RBBP7 cDNA ORF Clone in Cloning Vector, Mouse MG52620-U
RBBP7 cDNA ORF Clone, Mouse, untagged MG52620-UT
RBBP7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52620-ACGLN
RBBP7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52620-ACG
RBBP7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52620-ANG
RBBP7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52620-ACR
RBBP7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52620-ANR
RBBP7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52620-CF
RBBP7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52620-NF
RBBP7 cDNA ORF Clone, Mouse, C-His tag MG52620-CH
RBBP7 cDNA ORF Clone, Mouse, N-His tag MG52620-NH
RBBP7 cDNA ORF Clone, Mouse, C-HA tag MG52620-CY
RBBP7 cDNA ORF Clone, Mouse, N-HA tag MG52620-NY
RBBP7 cDNA ORF Clone, Mouse, C-Myc tag MG52620-CM
RBBP7 cDNA ORF Clone, Mouse, N-Myc tag MG52620-NM
RBBP7 qPCR Primer Pairs, Mouse MP202491

RBBP7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RBBP7 cDNA ORF Clone in Cloning Vector, Human HG16693-U
RBBP7 cDNA ORF Clone, Human, untagged HG16693-UT
RBBP7 cDNA ORF Clone, Human, C-GFPSpark® tag HG16693-ACG
RBBP7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16693-ACGLN
RBBP7 cDNA ORF Clone, Human, N-GFPSpark® tag HG16693-ANG
RBBP7 cDNA ORF Clone, Human, C-OFPSpark® tag HG16693-ACR
RBBP7 cDNA ORF Clone, Human, N-OFPSpark® tag HG16693-ANR
RBBP7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16693-CF
RBBP7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16693-NF
RBBP7 cDNA ORF Clone, Human, C-His tag HG16693-CH
RBBP7 cDNA ORF Clone, Human, N-His tag HG16693-NH
RBBP7 cDNA ORF Clone, Human, C-HA tag HG16693-CY
RBBP7 cDNA ORF Clone, Human, N-HA tag HG16693-NY
RBBP7 cDNA ORF Clone, Human, C-Myc tag HG16693-CM
RBBP7 cDNA ORF Clone, Human, N-Myc tag HG16693-NM
info info
添加购物车成功! 添加购物车失败!