After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

필리핀원숭이 SCN2B Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
Cynomolgus SCN2B cDNA 클론 제품 정보
Gene_bank_ref_id:XM_005579786.1
cDNA 크기:648bp
cDNA 설명:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) sodium channel, voltage-gated, type II, beta subunit with C terminal His tag.
유전자 동의어:SCN2B
:Cynomolgus
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
연구배경

SCN2B plays a key role in the assembly, expression, and functional modulation of the heterotrimeric complex of the sodium channel. Voltage-gated sodium channels (NaV) are composed of one pore-forming alpha-subunit, which may be associated with either one or more beta-subunits. Alpha-subunits are composed for four homologous domains, each of which contains six transmembrane segments.They are responsible for action potential initiation and propagation in excitable cells, including nerve, muscle, and neuroendocrine cell types. SCN2B causes an increase in the plasma membrane surface area and in its folding into microvilli. SCN2B also interacts with TNR and may play a crucial role in clustering and regulation of activity of sodium channels at nodes of ranvier.

참고자료
  • Kimura K, et al. (2006) Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. Genome Res. 16(1):55-65.
  • Tan BH, et al. (2010) Sudden infant death syndrome-associated mutations in the sodium channel beta subunits. Heart Rhythm. 7(6):771-8.
  • Watanabe H, et al. (2009) Mutations in sodium channel beta1- and beta2-subunits associated with atrial fibrillation. Circ Arrhythm Electrophysiol. 2(3):268-75. Kimura K et al., 2006, Genome Res. 16(1):55-65.
  • Size / Price
    Cat No: CG90365-CH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".