SF3B5 cDNA ORF Clone, Rhesus, N-HA tag

Cat: CG90411-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All SF3B5 Reagents

CRO Services

Product recommended


All SF3B5 Reagents

SF3B5 cDNA ORF Clone, Rhesus, N-HA tag General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
261 bp
Description
Full length Clone DNA of Rhesus splicing factor 3b, subunit 5, 10kDa with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SF3B5 Background Information

Full Name
splicing factor 3b subunit 5

SF3B5 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SF3B5 cDNA ORF Clone in Cloning Vector, Rhesus CG90411-G
SF3B5 cDNA ORF Clone, Rhesus, untagged CG90411-UT
SF3B5 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90411-ACG
SF3B5 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90411-ACGLN
SF3B5 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90411-ANG
SF3B5 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90411-ACR
SF3B5 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90411-ANR
SF3B5 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90411-CF
SF3B5 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90411-NF
SF3B5 cDNA ORF Clone, Rhesus, C-His tag CG90411-CH
SF3B5 cDNA ORF Clone, Rhesus, N-His tag CG90411-NH
SF3B5 cDNA ORF Clone, Rhesus, C-HA tag CG90411-CY
SF3B5 cDNA ORF Clone, Rhesus, C-Myc tag CG90411-CM
SF3B5 cDNA ORF Clone, Rhesus, N-Myc tag CG90411-NM

SF3B5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SF3B5 cDNA ORF Clone in Cloning Vector, Rat RG81278-U
SF3B5 cDNA ORF Clone, Rat, untagged RG81278-UT
SF3B5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81278-ACG
SF3B5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81278-ACGLN
SF3B5 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81278-ANG
SF3B5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81278-ACR
SF3B5 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81278-ANR
SF3B5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81278-CF
SF3B5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81278-NF
SF3B5 cDNA ORF Clone, Rat, C-His tag RG81278-CH
SF3B5 cDNA ORF Clone, Rat, N-His tag RG81278-NH
SF3B5 cDNA ORF Clone, Rat, C-HA tag RG81278-CY
SF3B5 cDNA ORF Clone, Rat, N-HA tag RG81278-NY
SF3B5 cDNA ORF Clone, Rat, C-Myc tag RG81278-CM
SF3B5 cDNA ORF Clone, Rat, N-Myc tag RG81278-NM
SF3B5 qPCR Primer Pairs, Rat RP301234

SF3B5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SF3B5 cDNA ORF Clone in Cloning Vector, Mouse MG52784-G
SF3B5 cDNA ORF Clone, Mouse, untagged MG52784-UT
SF3B5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52784-ACGLN
SF3B5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52784-ACG
SF3B5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52784-ANG
SF3B5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52784-ACR
SF3B5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52784-ANR
SF3B5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52784-CF
SF3B5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52784-NF
SF3B5 cDNA ORF Clone, Mouse, C-His tag MG52784-CH
SF3B5 cDNA ORF Clone, Mouse, N-His tag MG52784-NH
SF3B5 cDNA ORF Clone, Mouse, C-HA tag MG52784-CY
SF3B5 cDNA ORF Clone, Mouse, N-HA tag MG52784-NY
SF3B5 cDNA ORF Clone, Mouse, C-Myc tag MG52784-CM
SF3B5 cDNA ORF Clone, Mouse, N-Myc tag MG52784-NM

SF3B5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SF3B5 cDNA ORF Clone in Cloning Vector, Human HG16385-G
SF3B5 cDNA ORF Clone, Human, untagged HG16385-UT
SF3B5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16385-ACGLN
SF3B5 cDNA ORF Clone, Human, C-GFPSpark® tag HG16385-ACG
SF3B5 cDNA ORF Clone, Human, N-GFPSpark® tag HG16385-ANG
SF3B5 cDNA ORF Clone, Human, C-OFPSpark® tag HG16385-ACR
SF3B5 cDNA ORF Clone, Human, N-OFPSpark® tag HG16385-ANR
SF3B5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16385-CF
SF3B5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16385-NF
SF3B5 cDNA ORF Clone, Human, C-His tag HG16385-CH
SF3B5 cDNA ORF Clone, Human, N-His tag HG16385-NH
SF3B5 cDNA ORF Clone, Human, C-HA tag HG16385-CY
SF3B5 cDNA ORF Clone, Human, N-HA tag HG16385-NY
SF3B5 cDNA ORF Clone, Human, C-Myc tag HG16385-CM
SF3B5 cDNA ORF Clone, Human, N-Myc tag HG16385-NM
SF3B5 qPCR Primer Pairs, Human HP105134
info info
添加购物车成功! 添加购物车失败!