붉은털원숭이 SLC25A3 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
필리핀원숭이 SLC25A3 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001257587.1
cDNA 크기:1086bp
cDNA 설명:Full length Clone DNA of Macaca mulatta (Rhesus monkey) solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3.
유전자 동의어:SLC25A3
:Rhesus
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Cat No: CG90738-UT
정가: 
가격:      (You Save: )
Contact Us
이미지
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".