C1orf144 cDNA ORF Clone, Cynomolgus, C-His tag

Cat: CG90370-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All C1orf144 Reagents
CRO Services
Product recommended

All C1orf144 Reagents
C1orf144 cDNA ORF Clone, Cynomolgus, C-His tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
399 bp
Description
Full length Clone DNA of Cynomolgus SUZ RNA binding domain containing 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C1orf144 Background Information
Full Name
SUZ RNA binding domain containing 1

C1orf144 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
C1orf144 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90370-G
C1orf144 cDNA ORF Clone, Cynomolgus, untagged CG90370-UT
C1orf144 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90370-ACG
C1orf144 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90370-ACGLN
C1orf144 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90370-ANG
C1orf144 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90370-ACR
C1orf144 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90370-ANR
C1orf144 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90370-CF
C1orf144 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90370-NF
C1orf144 cDNA ORF Clone, Cynomolgus, N-His tag CG90370-NH
C1orf144 cDNA ORF Clone, Cynomolgus, C-HA tag CG90370-CY
C1orf144 cDNA ORF Clone, Cynomolgus, N-HA tag CG90370-NY
C1orf144 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90370-CM
C1orf144 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90370-NM

C1orf144 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
C1orf144 cDNA ORF Clone in Cloning Vector, Mouse MG53718-U
C1orf144 cDNA ORF Clone, Mouse, untagged MG53718-UT
C1orf144 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53718-ACGLN
C1orf144 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53718-ACG
C1orf144 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53718-ANG
C1orf144 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53718-ACR
C1orf144 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53718-ANR
C1orf144 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53718-CF
C1orf144 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53718-NF
C1orf144 cDNA ORF Clone, Mouse, C-His tag MG53718-CH
C1orf144 cDNA ORF Clone, Mouse, N-His tag MG53718-NH
C1orf144 cDNA ORF Clone, Mouse, C-HA tag MG53718-CY
C1orf144 cDNA ORF Clone, Mouse, N-HA tag MG53718-NY
C1orf144 cDNA ORF Clone, Mouse, C-Myc tag MG53718-CM
C1orf144 cDNA ORF Clone, Mouse, N-Myc tag MG53718-NM

C1orf144 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
C1orf144 cDNA ORF Clone in Cloning Vector, Human HG11493-G
C1orf144 cDNA ORF Clone, Human, untagged HG11493-UT
C1orf144 cDNA ORF Clone, Human, C-GFPSpark® tag HG11493-ACG
C1orf144 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11493-ACGLN
C1orf144 cDNA ORF Clone, Human, N-GFPSpark® tag HG11493-ANG
C1orf144 cDNA ORF Clone, Human, C-OFPSpark® tag HG11493-ACR
C1orf144 cDNA ORF Clone, Human, N-OFPSpark® tag HG11493-ANR
C1orf144 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11493-CF
C1orf144 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11493-NF
C1orf144 cDNA ORF Clone, Human, C-His tag HG11493-CH
C1orf144 cDNA ORF Clone, Human, N-His tag HG11493-NH
C1orf144 cDNA ORF Clone, Human, C-HA tag HG11493-CY
C1orf144 cDNA ORF Clone, Human, N-HA tag HG11493-NY
C1orf144 cDNA ORF Clone, Human, C-Myc tag HG11493-CM
C1orf144 cDNA ORF Clone, Human, N-Myc tag HG11493-NM
C1orf144 qPCR Primer Pairs, Human HP101369
info info
添加购物车成功! 添加购物车失败!