TNF-alpha cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90018-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TNF-alpha Reagents
CRO Services
Product recommended

All TNF-alpha Reagents
TNF-alpha cDNA ORF Clone, Rhesus, N-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
702 bp
Description
Full length Clone DNA of Rhesus tumor necrosis factor with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TNF-alpha Background Information

Tumor necrosis factor alpha (TNF-alpha), also known as TNF, TNFA or TNFSF2, is the prototypic cytokine of the TNF superfamily, and is a multifunctional molecule involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. Two receptors, TNF-R1 (TNF receptor type 1; CD120a; p55/60) and TNF-R2 (TNF receptor type 2; CD120b; p75/80), bind to TNF-alpha. TNF-alpha protein is produced mainly by macrophages, and large amounts of this cytokine are released in response to lipopolysaccharide, other bacterial products, and Interleukin-1 (IL-1). TNF-alpha is involved in fighting against the tumorigenesis, thus, is regarded as a molecular insight in cancer treatment.

TNF-alpha Protein & Antibody

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
tumor necrosis factor
Research Areas
References
  • Hector J, et al. (2007) TNF-alpha alters visfatin and adiponectin levels in human fat. Horm Metab Res. 39(4): 250-5.
  • Berthold-Losleben M, et al. (2008) The TNF-alpha System: Functional Aspects in Depression, Narcolepsy and Psychopharmacology. Curr Neuropharmacol. 6(3): 193-202.
  • TNF-alpha cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    TNF-alpha cDNA ORF Clone in Cloning Vector, Canine DG70003-M
    TNF-alpha cDNA ORF Clone, Canine, untagged DG70003-UT
    TNF-alpha cDNA ORF Clone, Canine, C-GFPSpark® tag DG70003-ACG
    TNF-alpha Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70003-ACGLN
    TNF-alpha cDNA ORF Clone, Canine, C-OFPSpark® tag DG70003-ACR
    TNF-alpha cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70003-CF
    TNF-alpha cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70003-NF
    TNF-alpha cDNA ORF Clone, Canine, C-His tag DG70003-CH
    TNF-alpha cDNA ORF Clone, Canine, N-His tag DG70003-NH
    TNF-alpha cDNA ORF Clone, Canine, C-HA tag DG70003-CY
    TNF-alpha cDNA ORF Clone, Canine, N-HA tag DG70003-NY
    TNF-alpha cDNA ORF Clone, Canine, C-Myc tag DG70003-CM
    TNF-alpha cDNA ORF Clone, Canine, N-Myc tag DG70003-NM

    TNF-alpha cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    TNF-alpha cDNA ORF Clone in Cloning Vector, Ferret FG60002-G
    TNF-alpha cDNA ORF Clone, Ferret, untagged FG60002-UT
    TNF-alpha cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60002-ACG
    TNF-alpha Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60002-ACGLN
    TNF-alpha cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60002-ACR
    TNF-alpha cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60002-CF
    TNF-alpha cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60002-NF
    TNF-alpha cDNA ORF Clone, Ferret, C-His tag FG60002-CH
    TNF-alpha cDNA ORF Clone, Ferret, N-His tag FG60002-NH
    TNF-alpha cDNA ORF Clone, Ferret, C-HA tag FG60002-CY
    TNF-alpha cDNA ORF Clone, Ferret, N-HA tag FG60002-NY
    TNF-alpha cDNA ORF Clone, Ferret, C-Myc tag FG60002-CM
    TNF-alpha cDNA ORF Clone, Ferret, N-Myc tag FG60002-NM

    TNF-alpha cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    TNF-alpha cDNA ORF Clone in Cloning Vector, Rhesus CG90018-G
    TNF-alpha cDNA ORF Clone, Rhesus, untagged CG90018-UT
    TNF-alpha Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90018-ACGLN
    TNF-alpha cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90018-ACG
    TNF-alpha cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90018-ACR
    TNF-alpha cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90018-CF
    TNF-alpha cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90018-NF
    TNF-alpha cDNA ORF Clone, Rhesus, C-His tag CG90018-CH
    TNF-alpha cDNA ORF Clone, Rhesus, N-His tag CG90018-NH
    TNF-alpha cDNA ORF Clone, Rhesus, C-HA tag CG90018-CY
    TNF-alpha cDNA ORF Clone, Rhesus, N-HA tag CG90018-NY
    TNF-alpha cDNA ORF Clone, Rhesus, C-Myc tag CG90018-CM

    TNF-alpha cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TNF-alpha cDNA ORF Clone in Cloning Vector, Rat RG80045-M
    TNF-alpha cDNA ORF Clone, Rat, untagged RG80045-UT
    TNF-alpha Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80045-ACGLN
    TNF-alpha cDNA ORF Clone, Rat, C-GFPSpark® tag RG80045-ACG
    TNF-alpha cDNA ORF Clone, Rat, C-OFPSpark® tag RG80045-ACR
    TNF-alpha cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80045-CF
    TNF-alpha cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80045-NF
    TNF-alpha cDNA ORF Clone, Rat, C-His tag RG80045-CH
    TNF-alpha cDNA ORF Clone, Rat, N-His tag RG80045-NH
    TNF-alpha cDNA ORF Clone, Rat, C-HA tag RG80045-CY
    TNF-alpha cDNA ORF Clone, Rat, N-HA tag RG80045-NY
    TNF-alpha cDNA ORF Clone, Rat, C-Myc tag RG80045-CM
    TNF-alpha cDNA ORF Clone, Rat, N-Myc tag RG80045-NM
    TNF-alpha qPCR Primer Pairs, Rat RP300044

    TNF-alpha cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TNF-alpha cDNA ORF Clone in Cloning Vector, Mouse MG50349-M
    TNF-alpha cDNA ORF Clone, Mouse, untagged MG50349-UT
    TNF-alpha Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50349-ACGLN
    TNF-alpha cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50349-ACG
    TNF-alpha cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50349-ACR
    TNF-alpha cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50349-CF
    TNF-alpha cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50349-NF
    TNF-alpha cDNA ORF Clone, Mouse, C-His tag MG50349-CH
    TNF-alpha cDNA ORF Clone, Mouse, N-His tag MG50349-NH
    TNF-alpha cDNA ORF Clone, Mouse, C-HA tag MG50349-CY
    TNF-alpha cDNA ORF Clone, Mouse, N-HA tag MG50349-NY
    TNF-alpha cDNA ORF Clone, Mouse, C-Myc tag MG50349-CM
    TNF-alpha cDNA ORF Clone, Mouse, N-Myc tag MG50349-NM
    TNF-alpha qPCR Primer Pairs, Mouse MP200370

    TNF-alpha cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TNF-alpha cDNA ORF Clone in Cloning Vector, Human HG10602-M
    TNF-alpha cDNA ORF Clone, Human, untagged HG10602-UT
    TNF-alpha cDNA ORF Clone, Human, C-GFPSpark® tag HG10602-ACG
    TNF-alpha Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10602-ACGLN
    TNF-alpha cDNA ORF Clone, Human, C-OFPSpark® tag HG10602-ACR
    TNF-alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10602-CF
    TNF-alpha cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10602-NF
    TNF-alpha cDNA ORF Clone, Human, C-His tag HG10602-CH
    TNF-alpha cDNA ORF Clone, Human, N-His tag HG10602-NH
    TNF-alpha cDNA ORF Clone, Human, C-HA tag HG10602-CY
    TNF-alpha cDNA ORF Clone, Human, N-HA tag HG10602-NY
    TNF-alpha cDNA ORF Clone, Human, C-Myc tag HG10602-CM
    TNF-alpha cDNA ORF Clone, Human, N-Myc tag HG10602-NM
    TNF-alpha qPCR Primer Pairs, Human HP100592
    info info
    添加购物车成功! 添加购物车失败!