E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Cynomolgus, N-Myc tag

Cat: CG90821-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All E1 Ubiquitin Activating Enzyme Reagents
CRO Services
Product recommended

All E1 Ubiquitin Activating Enzyme Reagents
E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Cynomolgus, N-Myc tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
3177 bp
Description
Full length Clone DNA of Cynomolgus ubiquitin-like modifier activating enzyme 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

E1 Ubiquitin Activating Enzyme Background Information

UBE1, also known as UBA1, belongs to the ubiquitin-activating E1 family. UBE1 gene complements an X-linked mouse temperature-sensitive defect in DNA synthesis, and thus may function in DNA repair. It is part of a gene cluster on chromosome Xp11.23. UBE1 catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation. It also catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation by first adenylating its C-terminal glycine residue with ATP, and thereafter linking this residue to the side chain of a cysteine residue in E1, yielding an ubiquitin-E1 thioester and free AMP. Defects in UBA1 can cause spinal muscular atrophy X-linked type 2 (SMAX2), also known as X-linked lethal infantile spinal muscular atrophy, distal X-linked arthrogryposis multiplex congenita or X-linked arthrogryposis type 1 (AMCX1). Spinal muscular atrophy refers to a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. SMAX2 is a lethal infantile form presenting with hypotonia, areflexia, and multiple congenital contractures.

Full Name
ubiquitin-like modifier activating enzyme 1
References
  • Jin J, et al. (2007) Dual E1 activation systems for ubiquitin differentially regulate E2 enzyme charging. Nature. 447(7148):1135-8.
  • Xia T, et al. (2007) Chaperone-dependent E3 ligase CHIP ubiquitinates and mediates proteasomal degradation of soluble guanylyl cyclase. Am J Physiol Heart Circ Physiol. 293(5):H3080-7.
  • Pridgeon JW, et al. (2009) Proteomic analysis reveals Hrs UIM-mediated ubiquitin signaling in multiple cellular processes. FEBS J. 276(1):118-31.
  • E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone in Cloning Vector, Cynomolgus CG90821-G
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Cynomolgus, untagged CG90821-UT
    E1 Ubiquitin Activating Enzyme Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90821-ACGLN
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90821-ACG
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90821-ANG
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90821-ACR
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90821-ANR
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90821-CF
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90821-NF
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Cynomolgus, C-His tag CG90821-CH
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Cynomolgus, N-His tag CG90821-NH
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Cynomolgus, C-HA tag CG90821-CY
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Cynomolgus, N-HA tag CG90821-NY
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Cynomolgus, C-Myc tag CG90821-CM

    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone in Cloning Vector, Mouse MG53774-U
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Mouse, untagged MG53774-UT
    E1 Ubiquitin Activating Enzyme Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53774-ACGLN
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53774-ACG
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53774-ANG
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53774-ACR
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53774-ANR
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53774-CF
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53774-NF
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Mouse, C-His tag MG53774-CH
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Mouse, N-His tag MG53774-NH
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Mouse, C-HA tag MG53774-CY
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Mouse, N-HA tag MG53774-NY
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Mouse, C-Myc tag MG53774-CM
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Mouse, N-Myc tag MG53774-NM

    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone in Cloning Vector, Human HG11990-U
    E1 Ubiquitin Activating Enzyme Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11990-ACGLN
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Human, C-GFPSpark® tag HG11990-ACG
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11990-CF
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11990-NF
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Human, C-His tag HG11990-CH
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Human, C-HA tag HG11990-CY
    E1 Ubiquitin Activating Enzyme cDNA ORF Clone, Human, C-Myc tag HG11990-CM
    E1 Ubiquitin Activating Enzyme qPCR Primer Pairs, Human HP101533
    info info
    添加购物车成功! 添加购物车失败!