UBL7 cDNA ORF Clone, Cynomolgus, untagged

Cat: CG90775-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UBL7 Reagents
CRO Services
Product recommended

All UBL7 Reagents
UBL7 cDNA ORF Clone, Cynomolgus, untagged General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1143 bp
Description
Full length Clone DNA of Cynomolgus ubiquitin-like 7 (bone marrow stromal cell-derived).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UBL7 Background Information
Full Name
ubiquitin-like 7

UBL7 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
UBL7 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90775-G
UBL7 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90775-ACGLN
UBL7 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90775-ACG
UBL7 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90775-ANG
UBL7 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90775-ACR
UBL7 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90775-ANR
UBL7 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90775-CF
UBL7 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90775-NF
UBL7 cDNA ORF Clone, Cynomolgus, C-His tag CG90775-CH
UBL7 cDNA ORF Clone, Cynomolgus, N-His tag CG90775-NH
UBL7 cDNA ORF Clone, Cynomolgus, C-HA tag CG90775-CY
UBL7 cDNA ORF Clone, Cynomolgus, N-HA tag CG90775-NY
UBL7 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90775-CM
UBL7 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90775-NM

UBL7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UBL7 cDNA ORF Clone in Cloning Vector, Human HG12690-U
UBL7 cDNA ORF Clone, Human, untagged HG12690-UT
UBL7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12690-ACGLN
UBL7 cDNA ORF Clone, Human, C-GFPSpark® tag HG12690-ACG
UBL7 cDNA ORF Clone, Human, N-GFPSpark® tag HG12690-ANG
UBL7 cDNA ORF Clone, Human, C-OFPSpark® tag HG12690-ACR
UBL7 cDNA ORF Clone, Human, N-OFPSpark® tag HG12690-ANR
UBL7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12690-CF
UBL7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12690-NF
UBL7 cDNA ORF Clone, Human, C-His tag HG12690-CH
UBL7 cDNA ORF Clone, Human, N-His tag HG12690-NH
UBL7 cDNA ORF Clone, Human, C-HA tag HG12690-CY
UBL7 cDNA ORF Clone, Human, N-HA tag HG12690-NY
UBL7 cDNA ORF Clone, Human, C-Myc tag HG12690-CM
UBL7 cDNA ORF Clone, Human, N-Myc tag HG12690-NM
info info
添加购物车成功! 添加购物车失败!