After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

필리핀원숭이 UCHL1 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Cynomolgus UCHL1 cDNA 클론 제품 정보
Gene_bank_ref_id:XM_005554754.1
cDNA 크기:672bp
cDNA 설명:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase).
유전자 동의어:UCH-L1
:Cynomolgus
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
연구배경

Ubiquitin carboxyl-terminal hydrolase isozyme L1, also known as UCH-L1, Ubiquitin thioesterase L1, PGP9.5 and UCHL1, is a deubiqutinating enzyme with important functions in recycling of ubiquitin. Regulated proteolysis by the ubiquitin pathway has been implicated in control of the cell cycle, transcriptional activation, cell fate and growth, and synaptogenesis. The ubiquitin-proteasome system is involved in synaptic plasticity and is proposed to be part of a molecular switch that converts short-term synaptic potentiation to long-term changes in synaptic strength. UCHL1 is found in neuronal cell bodies and processes throughout the neocortex (at protein level). It is expressed in neurons and cells of the diffuse neuroendocrine system and their tumors. UCHL1 is weakly expressed in ovary. UCHL1 is a ubiquitin-protein hydrolase. It is involved both in the processing of ubiquitin precursors and of ubiquitinated proteins. This enzyme is a thiol protease that recognizes and hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin. UCHL1 also binds to free monoubiquitin and may prevent its degradation in lysosomes. The homodimer of UCHL1 may have ATP-independent ubiquitin ligase activity. UCHL1 dysfunction has been associated with neurodegeneration in Parkinson's, Alzheimer's, and Huntington's disease patients. Reduced UCHL1 function may jeopardize the survival of CNS neurons.

참고자료
  • Wada H., et al., 1998, Biochem. Biophys. Res. Commun. 251:688-92.
  • Choi J., et al., 2004, J. Biol. Chem. 279:13256-64.
  • Lombardino,A.2005, et al., J.Proc Natl Acad Sci.USA102 (22):8036-41
  • Okochi-Takada,E. et al., 2006, Int J Cancer. 119 (6):1338-44.
  • Zetterberg, M. et al., 2010, Mol Neurodegener  5 :11.
  • Size / Price
    Cat No: CG90725-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".