After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

붉은털원숭이 14-3-3 beta/YWHAB Gene ORF cDNA clone expression plasmid, N-Myc 태그

데이터시트리뷰관련제품프로토콜
Cynomolgus YWHAB cDNA 클론 제품 정보
Gene_bank_ref_id:XM_001109676.2
cDNA 크기:735bp
cDNA 설명:Full length Clone DNA of Macaca mulatta (Rhesus monkey) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide with N terminal Myc tag.
유전자 동의어:YWHAB
:Rhesus
벡터:pCMV3-N-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

붉은털원숭이 14-3-3 beta/YWHAB Gene ORF cDNA clone expression plasmid, N-Myc 태그 on other vectors
붉은털원숭이 14-3-3 beta/YWHAB Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그CG90022-ACG265260
붉은털원숭이 14-3-3 beta/YWHAB Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그CG90022-ACR265260
붉은털원숭이 14-3-3 beta/YWHAB Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그CG90022-ANG265260
붉은털원숭이 14-3-3 beta/YWHAB Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그CG90022-ANR265260
붉은털원숭이 14-3-3 beta/YWHAB Gene ORF cDNA clone expression plasmid, C-Flag 태그CG90022-CF229890
붉은털원숭이 14-3-3 beta/YWHAB Gene ORF cDNA clone expression plasmid, C-His 태그CG90022-CH229890
붉은털원숭이 14-3-3 beta/YWHAB Gene ORF cDNA clone expression plasmid, C-Myc 태그CG90022-CM229890
붉은털원숭이 14-3-3 beta/YWHAB Gene ORF cDNA clone expression plasmid, C-HA 태그CG90022-CY229890
붉은털원숭이 14-3-3 beta/YWHAB Gene ORF cDNA clone in cloning vectorCG90022-G88420
붉은털원숭이 14-3-3 beta/YWHAB Gene ORF cDNA clone expression plasmid, N-Flag 태그CG90022-NF229890
붉은털원숭이 14-3-3 beta/YWHAB Gene ORF cDNA clone expression plasmid, N-His 태그CG90022-NH229890
붉은털원숭이 14-3-3 beta/YWHAB Gene ORF cDNA clone expression plasmid, N-Myc 태그CG90022-NM229890
붉은털원숭이 14-3-3 beta/YWHAB Gene ORF cDNA clone expression plasmid, N-HA 태그CG90022-NY229890
붉은털원숭이 14-3-3 beta/YWHAB Gene ORF cDNA clone expression plasmidCG90022-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

14-3-3 beta / YWHAB is a member of the 14-3-3 proteins family. 14-3-3 proteins are a group of highly conserved proteins that are involved in many vital cellular processes such as metabolism, protein trafficking, signal transduction, apoptosis and cell cycle regulation. 14-3-3 proteins are mainly localized in the synapses and neuronal cytoplasm, and seven isoforms have been identified in mammals. This family of proteins was initially identified as adaptor proteins which bind to phosphoserine-containing motifs. Binding motifs and potential functions of 14-3-3 proteins are now recognized to have a wide range of functional relevance. 14-3-3 beta / YWHAB is found in both plants and mammals, and this protein is 100% identical to the mouse ortholog. 14-3-3 beta / YWHAB interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. 14-3-3 beta / YWHAB has also been implicated in the pathogenesis of small cell lung cancer. 14-3-3 beta / YWHAB binding negatively regulates RSK1 activity to maintain signal specificity and that association/dissociation of the 14-3-3beta-RSK1 complex is likely to be important for mitogen-mediated RSK1 activation.

참고자료
  • Tommerup N, et al. (1996) Assignment of the human genes encoding 14,3-3 Eta (YWHAH) to 22q12, 14-3-3 zeta (YWHAZ) to 2p25.1-p25.2, and 14-3-3 beta (YWHAB) to 20q13.1 by in situ hybridization. Genomics. 33(1): 149-50.
  • Jin YH, et al. (2008) Sirt2 interacts with 14-3-3 beta/gamma and down-regulates the activity of p53. Biochem Biophys Res Commun. 368(3): 690-5.
  • Sekimoto T, et al. (2004) 14-3-3 suppresses the nuclear localization of threonine 157-phosphorylated p27(Kip1). EMBO J. 23(9): 1934-42.
  • Size / Price
    Cat No: CG90022-NM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".