After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-HA 태그

데이터시트리뷰관련제품프로토콜
DENV DENV-NS1 cDNA 클론 제품 정보
Gene_bank_ref_id:AF038403.1
cDNA 크기:1056bp
cDNA 설명:Full length Clone DNA of DENV-2 (strain New Guinea C) NS1 with C terminal HA tag.
유전자 동의어:DENV-NS1
:DENV
벡터:pCMV3-C-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-HA 태그 on other vectors
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-GFPSpark 태그VG40263-ACG383160
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-OFPSpark / RFP 태그VG40263-ACR383160
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-GFPSpark 태그VG40263-ANG383160
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-OFPSpark / RFP 태그VG40263-ANR383160
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-Flag 태그VG40263-CF347790
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-His 태그VG40263-CH347790
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-Myc 태그VG40263-CM347790
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-HA 태그VG40263-CY347790
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid (Codon Optimized)VG40263-G112000
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-Flag 태그VG40263-NF347790
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-His 태그VG40263-NH347790
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-Myc 태그VG40263-NM347790
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-HA 태그VG40263-NY347790
Dengue virus DENV-2 (strain New Guinea C) NS1 natural ORF mammalian expression plasmidVG40263-UT347790
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".