After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-HA 태그

데이터시트리뷰관련제품프로토콜
DENV DENV-NS5A cDNA 클론 제품 정보
Gene_bank_ref_id:AF038403.1
cDNA 크기:2700bp
cDNA 설명:Full length Clone DNA of DENV-2 (strain New Guinea C) NS5A with C terminal HA tag.
유전자 동의어:DENV-NS5A
:DENV
벡터:pCMV3-C-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:Identical with the Gene Bank Ref. ID sequence AF038403.1 (7570..10269), corresponding to amino acid sequence AAC59275.1 (aa 2492-3391).
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-HA 태그 on other vectors
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-GFPSpark 태그VG40267-ACG501050
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-OFPSpark / RFP 태그VG40267-ACR501050
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, N-GFPSpark 태그VG40267-ANG501050
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, N-OFPSpark / RFP 태그VG40267-ANR501050
Dengue virus DENV-2 (strain New Guinea C) NS5A Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40267-CF465680
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-His 태그VG40267-CH465680
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-Myc 태그VG40267-CM465680
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-HA 태그VG40267-CY465680
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid (Codon Optimized)VG40267-G170950
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, N-Flag 태그VG40267-NF465680
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, N-His 태그VG40267-NH465680
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, N-Myc 태그VG40267-NM465680
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, N-HA 태그VG40267-NY465680
Dengue virus DENV-2 (strain New Guinea C) NS5A natural ORF mammalian expression plasmidVG40267-UT465680
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: VG40267-CY
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보2-3 weeks
대량 주문 문의장바구니에 추가
Contact Us
이미지
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".