After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 E2F2 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human E2F2 cDNA 클론 제품 정보
Gene_bank_ref_id:
cDNA 크기:
cDNA 설명:
유전자 동의어:
:Human
벡터:
제한 사이트:
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:
보관:
Human E2F2 Gene Plasmid Map
Human E2F2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Contact Us
이미지
  • Human E2F2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".