Text Size:AAA

휴먼 ELF5 Gene ORF cDNA clone expression plasmid

Human ELF5 cDNA 클론 제품 정보
cDNA 크기:768bp
cDNA 설명:Full length Clone DNA of Homo sapiens E74-like factor 5 (ets domain transcription factor).
유전자 동의어:ESE2
제한 사이트:KpnI + XhoI (5.5kb + 0.77kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human ELF5 Gene Plasmid Map
Human ELF5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
휴먼 ELF5 Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name
Size / Price
Cat No: HG12490-G-N
가격:      (You Save: )
재고정보In Stock
대량 주문 문의장바구니에 추가
Contact Us
  • Human ELF5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".