휴먼 FABP3/H-FABP Gene ORF cDNA clone expression plasmid

  • Human FABP3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
데이터시트리뷰관련제품프로토콜
휴먼 FABP3 cDNA 클론 제품 정보
Gene_bank_ref_id:
cDNA 크기:
cDNA 설명:
유전자 동의어:
:Human
벡터:
제한 사이트:
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:( We provide with FABP3 qPCR primers for gene expression analysis, HP104804 )
Shipping_carrier:
보관:
휴먼 FABP3 Gene Plasmid Map
Human FABP3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Datasheet & Documentation

Contact Us
    최근에 조회한 품목
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".