ARPP-19 cDNA ORF Clone, Ferret, N-HA tag

Cat: FG60056-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ARPP-19 Reagents
CRO Services
Product recommended

All ARPP-19 Reagents
ARPP-19 cDNA ORF Clone, Ferret, N-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
339 bp
Description
Full length Clone DNA of Ferret cAMP-regulated phosphoprotein, 19kDa with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARPP-19 Background Information
Full Name
cAMP-regulated phosphoprotein, 19kDa

ARPP-19 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
ARPP-19 cDNA ORF Clone in Cloning Vector, Ferret FG60056-G
ARPP-19 cDNA ORF Clone, Ferret, untagged FG60056-UT
ARPP-19 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60056-ACG
ARPP-19 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60056-ACGLN
ARPP-19 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60056-ANG
ARPP-19 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60056-ACR
ARPP-19 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60056-ANR
ARPP-19 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60056-CF
ARPP-19 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60056-NF
ARPP-19 cDNA ORF Clone, Ferret, C-His tag FG60056-CH
ARPP-19 cDNA ORF Clone, Ferret, N-His tag FG60056-NH
ARPP-19 cDNA ORF Clone, Ferret, C-HA tag FG60056-CY
ARPP-19 cDNA ORF Clone, Ferret, C-Myc tag FG60056-CM
ARPP-19 cDNA ORF Clone, Ferret, N-Myc tag FG60056-NM

ARPP-19 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARPP-19 cDNA ORF Clone in Cloning Vector, Human HG16201-G
ARPP-19 cDNA ORF Clone, Human, untagged HG16201-UT
ARPP-19 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16201-ACGLN
ARPP-19 cDNA ORF Clone, Human, C-GFPSpark® tag HG16201-ACG
ARPP-19 cDNA ORF Clone, Human, N-GFPSpark® tag HG16201-ANG
ARPP-19 cDNA ORF Clone, Human, C-OFPSpark® tag HG16201-ACR
ARPP-19 cDNA ORF Clone, Human, N-OFPSpark® tag HG16201-ANR
ARPP-19 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16201-CF
ARPP-19 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16201-NF
ARPP-19 cDNA ORF Clone, Human, C-His tag HG16201-CH
ARPP-19 cDNA ORF Clone, Human, N-His tag HG16201-NH
ARPP-19 cDNA ORF Clone, Human, C-HA tag HG16201-CY
ARPP-19 cDNA ORF Clone, Human, N-HA tag HG16201-NY
ARPP-19 cDNA ORF Clone, Human, C-Myc tag HG16201-CM
ARPP-19 cDNA ORF Clone, Human, N-Myc tag HG16201-NM
ARPP-19 qPCR Primer Pairs, Human HP104967
info info
添加购物车成功! 添加购物车失败!