흰족제비 ATP6V1B2 Gene ORF cDNA clone expression plasmid, C-His 태그

    데이터시트리뷰관련제품프로토콜
    흰족제비 ATP6V1B2 cDNA 클론 제품 정보
    Gene_bank_ref_id:XM_004763332.1
    cDNA 크기:1536bp
    cDNA 설명:Full length Clone DNA of Mustela putorius furo (sub-species: furo) ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 with C terminal His tag.
    유전자 동의어:ATP6V1B2
    :Ferret
    벡터:pCMV3-C-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Size / Price
    Cat No: FG60147-CH
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".