흰족제비 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, C-Myc 태그

    데이터시트리뷰관련제품프로토콜
    흰족제비 CA2 cDNA 클론 제품 정보
    Gene_bank_ref_id:XM_004766964.1
    cDNA 크기:783bp
    cDNA 설명:Full length Clone DNA of Mustela putorius furo (sub-species: furo) carbonic anhydrase II with C terminal Myc tag.
    유전자 동의어:CA2
    :Ferret
    벡터:pCMV3-C-Myc
    Plasmid:
    제한 사이트:
    태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    흰족제비 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, C-Myc 태그 on other vectors
    흰족제비 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그FG60084-ACG265260
    흰족제비 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그FG60084-ACR265260
    흰족제비 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그FG60084-ANG265260
    흰족제비 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그FG60084-ANR265260
    흰족제비 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, C-Flag 태그FG60084-CF229890
    흰족제비 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, C-His 태그FG60084-CH229890
    흰족제비 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, C-Myc 태그FG60084-CM229890
    흰족제비 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, C-HA 태그FG60084-CY229890
    흰족제비 Carbonic Anhydrase II Gene ORF cDNA clone in cloning vectorFG60084-G88420
    흰족제비 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, N-Flag 태그FG60084-NF229890
    흰족제비 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, N-His 태그FG60084-NH229890
    흰족제비 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, N-Myc 태그FG60084-NM229890
    흰족제비 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmid, N-HA 태그FG60084-NY229890
    흰족제비 Carbonic Anhydrase II Gene ORF cDNA clone expression plasmidFG60084-UT229890
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    연구배경

    The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase II is one of fourteen forms of human α carbonic anhydrases. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. Renal carbonic anhydrase allows the reabsorption of sodium ions in the proximal tubule. Carbonic anhydrase II has been shown to interact with Band 3 and Sodium-hydrogen antiporter 1.

    참고자료
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lilias A, et al. (1972) Crystal Structure of Human Carbonic Anhydrase C. Nature new biology. 235: 131-7.
  • Li XJ, et al. (2002) Carbonic Anhydrase II Binds to and Enhances Activity of the Na+/H+ Exchanger. The Journal of Biological Chemistry. 277: 36085-91.
  • Size / Price
    Cat No: FG60084-CM
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".