CaMKII/CAMK2G cDNA ORF Clone, Ferret, C-His tag

Cat: FG60160-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CaMKII/CAMK2G Reagents
CRO Services
Product recommended

All CaMKII/CAMK2G Reagents
CaMKII/CAMK2G cDNA ORF Clone, Ferret, C-His tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1488 bp
Description
Full length Clone DNA of Ferret calcium>calmodulin-dependent protein kinase II gamma with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CaMKII/CAMK2G Background Information
Full Name
calcium/calmodulin-dependent protein kinase II gamma

CaMKII/CAMK2G cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
CaMKII/CAMK2G cDNA ORF Clone in Cloning Vector, Ferret FG60160-G
CaMKII/CAMK2G cDNA ORF Clone, Ferret, untagged FG60160-UT
CaMKII/CAMK2G Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60160-ACGLN
CaMKII/CAMK2G cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60160-ACG
CaMKII/CAMK2G cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60160-ANG
CaMKII/CAMK2G cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60160-ACR
CaMKII/CAMK2G cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60160-ANR
CaMKII/CAMK2G cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60160-CF
CaMKII/CAMK2G cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60160-NF
CaMKII/CAMK2G cDNA ORF Clone, Ferret, N-His tag FG60160-NH
CaMKII/CAMK2G cDNA ORF Clone, Ferret, C-HA tag FG60160-CY
CaMKII/CAMK2G cDNA ORF Clone, Ferret, N-HA tag FG60160-NY
CaMKII/CAMK2G cDNA ORF Clone, Ferret, C-Myc tag FG60160-CM
CaMKII/CAMK2G cDNA ORF Clone, Ferret, N-Myc tag FG60160-NM

CaMKII/CAMK2G cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CaMKII/CAMK2G cDNA ORF Clone in Cloning Vector, Human HG11125-M
CaMKII/CAMK2G cDNA ORF Clone, Human, untagged HG11125-UT
CaMKII/CAMK2G Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11125-ACGLN
CaMKII/CAMK2G cDNA ORF Clone, Human, C-GFPSpark® tag HG11125-ACG
CaMKII/CAMK2G cDNA ORF Clone, Human, N-GFPSpark® tag HG11125-ANG
CaMKII/CAMK2G cDNA ORF Clone, Human, C-OFPSpark® tag HG11125-ACR
CaMKII/CAMK2G cDNA ORF Clone, Human, N-OFPSpark® tag HG11125-ANR
CaMKII/CAMK2G cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11125-CF
CaMKII/CAMK2G cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11125-NF
CaMKII/CAMK2G cDNA ORF Clone, Human, C-His tag HG11125-CH
CaMKII/CAMK2G cDNA ORF Clone, Human, N-His tag HG11125-NH
CaMKII/CAMK2G cDNA ORF Clone, Human, C-HA tag HG11125-CY
CaMKII/CAMK2G cDNA ORF Clone, Human, N-HA tag HG11125-NY
CaMKII/CAMK2G cDNA ORF Clone, Human, C-Myc tag HG11125-CM
CaMKII/CAMK2G cDNA ORF Clone, Human, N-Myc tag HG11125-NM
CaMKII/CAMK2G qPCR Primer Pairs, Human HP101037
info info
添加购物车成功! 添加购物车失败!