DHPS cDNA ORF Clone, Ferret, C-Myc tag

Cat: FG60064-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All DHPS Reagents

CRO Services

Product recommended


All DHPS Reagents

DHPS cDNA ORF Clone, Ferret, C-Myc tag General Information

Gene

Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1110 bp
Description
Full length Clone DNA of Ferret deoxyhypusine synthase with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DHPS Background Information

Full Name
deoxyhypusine synthase

DHPS cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
DHPS cDNA ORF Clone in Cloning Vector, Ferret FG60064-G
DHPS cDNA ORF Clone, Ferret, untagged FG60064-UT
DHPS cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60064-ACG
DHPS Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60064-ACGLN
DHPS cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60064-ANG
DHPS cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60064-ACR
DHPS cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60064-ANR
DHPS cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60064-CF
DHPS cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60064-NF
DHPS cDNA ORF Clone, Ferret, C-His tag FG60064-CH
DHPS cDNA ORF Clone, Ferret, N-His tag FG60064-NH
DHPS cDNA ORF Clone, Ferret, C-HA tag FG60064-CY
DHPS cDNA ORF Clone, Ferret, N-HA tag FG60064-NY
DHPS cDNA ORF Clone, Ferret, N-Myc tag FG60064-NM

DHPS cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DHPS cDNA ORF Clone in Cloning Vector, Mouse MG51544-G
DHPS cDNA ORF Clone, Mouse, untagged MG51544-UT
DHPS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51544-ACGLN
DHPS cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51544-ACG
DHPS cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51544-ANG
DHPS cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51544-ACR
DHPS cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51544-ANR
DHPS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51544-CF
DHPS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51544-NF
DHPS cDNA ORF Clone, Mouse, C-His tag MG51544-CH
DHPS cDNA ORF Clone, Mouse, N-His tag MG51544-NH
DHPS cDNA ORF Clone, Mouse, C-HA tag MG51544-CY
DHPS cDNA ORF Clone, Mouse, N-HA tag MG51544-NY
DHPS cDNA ORF Clone, Mouse, C-Myc tag MG51544-CM
DHPS cDNA ORF Clone, Mouse, N-Myc tag MG51544-NM
DHPS qPCR Primer Pairs, Mouse MP201428

DHPS cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DHPS cDNA ORF Clone in Cloning Vector, Human HG14407-G
DHPS cDNA ORF Clone, Human, untagged HG14407-UT
DHPS cDNA ORF Clone, Human, C-GFPSpark® tag HG14407-ACG
DHPS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14407-ACGLN
DHPS cDNA ORF Clone, Human, N-GFPSpark® tag HG14407-ANG
DHPS cDNA ORF Clone, Human, C-OFPSpark® tag HG14407-ACR
DHPS cDNA ORF Clone, Human, N-OFPSpark® tag HG14407-ANR
DHPS cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14407-CF
DHPS cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14407-NF
DHPS cDNA ORF Clone, Human, C-His tag HG14407-CH
DHPS cDNA ORF Clone, Human, N-His tag HG14407-NH
DHPS cDNA ORF Clone, Human, C-HA tag HG14407-CY
DHPS cDNA ORF Clone, Human, N-HA tag HG14407-NY
DHPS cDNA ORF Clone, Human, C-Myc tag HG14407-CM
DHPS cDNA ORF Clone, Human, N-Myc tag HG14407-NM
DHPS qPCR Primer Pairs, Human HP103056
info info
添加购物车成功! 添加购物车失败!