dUTPase cDNA ORF Clone, Ferret, C-HA tag

Cat: FG60042-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All dUTPase Reagents
CRO Services
Product recommended

All dUTPase Reagents
dUTPase cDNA ORF Clone, Ferret, C-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
426 bp
Description
Full length Clone DNA of Ferret deoxyuridine triphosphatase with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

dUTPase Background Information
Full Name
deoxyuridine triphosphatase

dUTPase cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
dUTPase cDNA ORF Clone in Cloning Vector, Ferret FG60042-G
dUTPase cDNA ORF Clone, Ferret, untagged FG60042-UT
dUTPase cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60042-ACG
dUTPase Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60042-ACGLN
dUTPase cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60042-ANG
dUTPase cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60042-ACR
dUTPase cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60042-ANR
dUTPase cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60042-CF
dUTPase cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60042-NF
dUTPase cDNA ORF Clone, Ferret, C-His tag FG60042-CH
dUTPase cDNA ORF Clone, Ferret, N-His tag FG60042-NH
dUTPase cDNA ORF Clone, Ferret, N-HA tag FG60042-NY
dUTPase cDNA ORF Clone, Ferret, C-Myc tag FG60042-CM
dUTPase cDNA ORF Clone, Ferret, N-Myc tag FG60042-NM

dUTPase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
dUTPase cDNA ORF Clone in Cloning Vector, Mouse MG5A2058-U
dUTPase cDNA ORF Clone, Mouse, untagged MG5A2058-UT
dUTPase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2058-ACG
dUTPase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2058-ACGLN
dUTPase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A2058-ANG
dUTPase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2058-ACR
dUTPase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A2058-ANR
dUTPase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2058-CF
dUTPase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2058-NF
dUTPase cDNA ORF Clone, Mouse, C-His tag MG5A2058-CH
dUTPase cDNA ORF Clone, Mouse, N-His tag MG5A2058-NH
dUTPase cDNA ORF Clone, Mouse, C-HA tag MG5A2058-CY
dUTPase cDNA ORF Clone, Mouse, N-HA tag MG5A2058-NY
dUTPase cDNA ORF Clone, Mouse, C-Myc tag MG5A2058-CM
dUTPase cDNA ORF Clone, Mouse, N-Myc tag MG5A2058-NM

dUTPase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
dUTPase cDNA ORF Clone in Cloning Vector, Human HG18603-U
dUTPase cDNA ORF Clone, Human, untagged HG18603-UT
dUTPase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18603-ACGLN
dUTPase cDNA ORF Clone, Human, C-GFPSpark® tag HG18603-ACG
dUTPase cDNA ORF Clone, Human, N-GFPSpark® tag HG18603-ANG
dUTPase cDNA ORF Clone, Human, C-OFPSpark® tag HG18603-ACR
dUTPase cDNA ORF Clone, Human, N-OFPSpark® tag HG18603-ANR
dUTPase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18603-CF
dUTPase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18603-NF
dUTPase cDNA ORF Clone, Human, C-His tag HG18603-CH
dUTPase cDNA ORF Clone, Human, N-His tag HG18603-NH
dUTPase cDNA ORF Clone, Human, C-HA tag HG18603-CY
dUTPase cDNA ORF Clone, Human, N-HA tag HG18603-NY
dUTPase cDNA ORF Clone, Human, C-Myc tag HG18603-CM
dUTPase cDNA ORF Clone, Human, N-Myc tag HG18603-NM
info info
添加购物车成功! 添加购物车失败!