Text Size:AAA

흰족제비 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Ferret ENO1 cDNA 클론 제품 정보
Gene_bank_ref_id:XM_004768617.1
cDNA 크기:1305bp
cDNA 설명:Full length Clone DNA of Mustela putorius furo (sub-species: furo) enolase 1, (alpha) with N terminal Flag tag.
유전자 동의어:ENO1
:Ferret
벡터:pCMV3-N-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

흰족제비 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-Flag 태그 on other vectors
흰족제비 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그FG60094-ACG265260
흰족제비 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그FG60094-ACR265260
흰족제비 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그FG60094-ANG265260
흰족제비 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그FG60094-ANR265260
흰족제비 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-Flag 태그FG60094-CF229890
흰족제비 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-His 태그FG60094-CH229890
흰족제비 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-Myc 태그FG60094-CM229890
흰족제비 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-HA 태그FG60094-CY229890
흰족제비 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone in cloning vectorFG60094-G88420
흰족제비 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-Flag 태그FG60094-NF229890
흰족제비 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-His 태그FG60094-NH229890
흰족제비 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-Myc 태그FG60094-NM229890
흰족제비 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-HA 태그FG60094-NY229890
흰족제비 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmidFG60094-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
참고자료
  • Capello M, et al. (2011) a-Enolase: a promising therapeutic and diagnostic tumor target. FEBS J. 278(7): 1064-74.
  • Kang HJ, et al. (2008) Structure of human alpha-enolase (hENO1), a multifunctional glycolytic enzyme. Acta Crystallogr D Biol Crystallogr. 64(Pt 6): 651-7.
  • Lopez-Alemany R, et al. (2005) Alpha-enolase plasminogen receptor in myogenesis. Front Biosci. 10: 30-6.
  • Ejeskdr K, et al. (2005) Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death. BMC Cancer. 5: 161.
  • Size / Price
    Cat No: FG60094-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".