ETFB cDNA ORF Clone, Ferret, N-DDK (Flag®) tag

Cat: FG60075-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ETFB Reagents

CRO Services

Product recommended


All ETFB Reagents

ETFB cDNA ORF Clone, Ferret, N-DDK (Flag®) tag General Information

Gene

Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
768 bp
Description
Full length Clone DNA of Ferret electron-transfer-flavoprotein, beta polypeptide with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ETFB Background Information

Full Name
electron-transfer-flavoprotein, beta polypeptide

ETFB cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
ETFB cDNA ORF Clone in Cloning Vector, Ferret FG60075-G
ETFB cDNA ORF Clone, Ferret, untagged FG60075-UT
ETFB cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60075-ACG
ETFB Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60075-ACGLN
ETFB cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60075-ANG
ETFB cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60075-ACR
ETFB cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60075-ANR
ETFB cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60075-CF
ETFB cDNA ORF Clone, Ferret, C-His tag FG60075-CH
ETFB cDNA ORF Clone, Ferret, N-His tag FG60075-NH
ETFB cDNA ORF Clone, Ferret, C-HA tag FG60075-CY
ETFB cDNA ORF Clone, Ferret, N-HA tag FG60075-NY
ETFB cDNA ORF Clone, Ferret, C-Myc tag FG60075-CM
ETFB cDNA ORF Clone, Ferret, N-Myc tag FG60075-NM

ETFB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ETFB cDNA ORF Clone in Cloning Vector, Mouse MG52265-G
ETFB cDNA ORF Clone, Mouse, untagged MG52265-UT
ETFB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52265-ACGLN
ETFB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52265-ACG
ETFB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52265-ANG
ETFB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52265-ACR
ETFB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52265-ANR
ETFB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52265-CF
ETFB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52265-NF
ETFB cDNA ORF Clone, Mouse, C-His tag MG52265-CH
ETFB cDNA ORF Clone, Mouse, N-His tag MG52265-NH
ETFB cDNA ORF Clone, Mouse, C-HA tag MG52265-CY
ETFB cDNA ORF Clone, Mouse, N-HA tag MG52265-NY
ETFB cDNA ORF Clone, Mouse, C-Myc tag MG52265-CM
ETFB cDNA ORF Clone, Mouse, N-Myc tag MG52265-NM
ETFB qPCR Primer Pairs, Mouse MP202138

ETFB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ETFB cDNA ORF Clone in Cloning Vector, Human HG17036-U
ETFB cDNA ORF Clone, Human, untagged HG17036-UT
ETFB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17036-ACGLN
ETFB cDNA ORF Clone, Human, C-GFPSpark® tag HG17036-ACG
ETFB cDNA ORF Clone, Human, N-GFPSpark® tag HG17036-ANG
ETFB cDNA ORF Clone, Human, C-OFPSpark® tag HG17036-ACR
ETFB cDNA ORF Clone, Human, N-OFPSpark® tag HG17036-ANR
ETFB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17036-CF
ETFB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17036-NF
ETFB cDNA ORF Clone, Human, C-His tag HG17036-CH
ETFB cDNA ORF Clone, Human, N-His tag HG17036-NH
ETFB cDNA ORF Clone, Human, C-HA tag HG17036-CY
ETFB cDNA ORF Clone, Human, N-HA tag HG17036-NY
ETFB cDNA ORF Clone, Human, C-Myc tag HG17036-CM
ETFB cDNA ORF Clone, Human, N-Myc tag HG17036-NM
info info
添加购物车成功! 添加购物车失败!