Factor XIIIa cDNA ORF Clone, Ferret, N-DDK (Flag®) tag

Cat: FG60076-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Factor XIIIa Reagents

CRO Services

Product recommended


All Factor XIIIa Reagents

Factor XIIIa cDNA ORF Clone, Ferret, N-DDK (Flag®) tag General Information

Gene

Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
2199 bp
Description
Full length Clone DNA of Ferret coagulation factor XIII, A1 polypeptide with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Factor XIIIa Background Information

Full Name
coagulation factor XIII, A1 polypeptide

Factor XIIIa cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
Factor XIIIa cDNA ORF Clone in Cloning Vector, Ferret FG60076-G
Factor XIIIa cDNA ORF Clone, Ferret, untagged FG60076-UT
Factor XIIIa cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60076-ACG
Factor XIIIa Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60076-ACGLN
Factor XIIIa cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60076-ANG
Factor XIIIa cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60076-ACR
Factor XIIIa cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60076-ANR
Factor XIIIa cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60076-CF
Factor XIIIa cDNA ORF Clone, Ferret, C-His tag FG60076-CH
Factor XIIIa cDNA ORF Clone, Ferret, N-His tag FG60076-NH
Factor XIIIa cDNA ORF Clone, Ferret, C-HA tag FG60076-CY
Factor XIIIa cDNA ORF Clone, Ferret, N-HA tag FG60076-NY
Factor XIIIa cDNA ORF Clone, Ferret, C-Myc tag FG60076-CM
Factor XIIIa cDNA ORF Clone, Ferret, N-Myc tag FG60076-NM

Factor XIIIa cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Factor XIIIa cDNA ORF Clone in Cloning Vector, Mouse MG53118-G
Factor XIIIa cDNA ORF Clone, Mouse, untagged MG53118-UT
Factor XIIIa cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53118-ACG
Factor XIIIa Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53118-ACGLN
Factor XIIIa cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53118-ANG
Factor XIIIa cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53118-ACR
Factor XIIIa cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53118-ANR
Factor XIIIa cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53118-CF
Factor XIIIa cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53118-NF
Factor XIIIa cDNA ORF Clone, Mouse, C-His tag MG53118-CH
Factor XIIIa cDNA ORF Clone, Mouse, N-His tag MG53118-NH
Factor XIIIa cDNA ORF Clone, Mouse, C-HA tag MG53118-CY
Factor XIIIa cDNA ORF Clone, Mouse, N-HA tag MG53118-NY
Factor XIIIa cDNA ORF Clone, Mouse, C-Myc tag MG53118-CM
Factor XIIIa cDNA ORF Clone, Mouse, N-Myc tag MG53118-NM

Factor XIIIa cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Factor XIIIa cDNA ORF Clone in Cloning Vector, Human HG11767-G
Factor XIIIa cDNA ORF Clone, Human, untagged HG11767-UT
Factor XIIIa Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11767-ACGLN
Factor XIIIa cDNA ORF Clone, Human, C-GFPSpark® tag HG11767-ACG
Factor XIIIa cDNA ORF Clone, Human, C-OFPSpark® tag HG11767-ACR
Factor XIIIa cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11767-CF
Factor XIIIa cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11767-NF
Factor XIIIa cDNA ORF Clone, Human, C-His tag HG11767-CH
Factor XIIIa cDNA ORF Clone, Human, N-His tag HG11767-NH
Factor XIIIa cDNA ORF Clone, Human, C-HA tag HG11767-CY
Factor XIIIa cDNA ORF Clone, Human, N-HA tag HG11767-NY
Factor XIIIa cDNA ORF Clone, Human, C-Myc tag HG11767-CM
Factor XIIIa cDNA ORF Clone, Human, N-Myc tag HG11767-NM
Factor XIIIa qPCR Primer Pairs, Human HP103199
info info
添加购物车成功! 添加购物车失败!