FAM188A cDNA ORF Clone, Ferret, N-HA tag

Cat: FG60046-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FAM188A Reagents
CRO Services
Product recommended

All FAM188A Reagents
FAM188A cDNA ORF Clone, Ferret, N-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1338 bp
Description
Full length Clone DNA of Ferret family with sequence similarity 188, member A with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAM188A Background Information
Full Name
family with sequence similarity 188, member A

FAM188A cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
FAM188A cDNA ORF Clone in Cloning Vector, Ferret FG60046-G
FAM188A cDNA ORF Clone, Ferret, untagged FG60046-UT
FAM188A Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60046-ACGLN
FAM188A cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60046-ACG
FAM188A cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60046-ANG
FAM188A cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60046-ACR
FAM188A cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60046-ANR
FAM188A cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60046-CF
FAM188A cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60046-NF
FAM188A cDNA ORF Clone, Ferret, C-His tag FG60046-CH
FAM188A cDNA ORF Clone, Ferret, N-His tag FG60046-NH
FAM188A cDNA ORF Clone, Ferret, C-HA tag FG60046-CY
FAM188A cDNA ORF Clone, Ferret, C-Myc tag FG60046-CM
FAM188A cDNA ORF Clone, Ferret, N-Myc tag FG60046-NM

FAM188A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FAM188A cDNA ORF Clone in Cloning Vector, Rat RG81381-G

FAM188A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FAM188A cDNA ORF Clone in Cloning Vector, Mouse MG53473-G
FAM188A cDNA ORF Clone, Mouse, untagged MG53473-UT
FAM188A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53473-ACGLN
FAM188A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53473-ACG
FAM188A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53473-ANG
FAM188A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53473-ACR
FAM188A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53473-ANR
FAM188A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53473-CF
FAM188A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53473-NF
FAM188A cDNA ORF Clone, Mouse, C-His tag MG53473-CH
FAM188A cDNA ORF Clone, Mouse, N-His tag MG53473-NH
FAM188A cDNA ORF Clone, Mouse, C-HA tag MG53473-CY
FAM188A cDNA ORF Clone, Mouse, N-HA tag MG53473-NY
FAM188A cDNA ORF Clone, Mouse, C-Myc tag MG53473-CM
FAM188A cDNA ORF Clone, Mouse, N-Myc tag MG53473-NM

FAM188A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FAM188A cDNA ORF Clone in Cloning Vector, Human HG23082-U
FAM188A cDNA ORF Clone, Human, untagged HG23082-UT
FAM188A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG23082-ACGLN
FAM188A cDNA ORF Clone, Human, C-GFPSpark® tag HG23082-ACG
FAM188A cDNA ORF Clone, Human, N-GFPSpark® tag HG23082-ANG
FAM188A cDNA ORF Clone, Human, C-OFPSpark® tag HG23082-ACR
FAM188A cDNA ORF Clone, Human, N-OFPSpark® tag HG23082-ANR
FAM188A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG23082-CF
FAM188A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG23082-NF
FAM188A cDNA ORF Clone, Human, C-His tag HG23082-CH
FAM188A cDNA ORF Clone, Human, N-His tag HG23082-NH
FAM188A cDNA ORF Clone, Human, C-HA tag HG23082-CY
FAM188A cDNA ORF Clone, Human, N-HA tag HG23082-NY
FAM188A cDNA ORF Clone, Human, C-Myc tag HG23082-CM
FAM188A cDNA ORF Clone, Human, N-Myc tag HG23082-NM
info info
添加购物车成功! 添加购物车失败!