After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, N-HA 태그

데이터시트리뷰관련제품프로토콜
Ferret IFNG cDNA 클론 제품 정보
Gene_bank_ref_id:AB300566.1
cDNA 크기:501bp
cDNA 설명:Full length Clone DNA of Ferret Interferon gamma with N terminal HA tag.
유전자 동의어:IFNG
:Ferret
벡터:pCMV3-SP-N-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, N-HA 태그 on other vectors
흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그FG60007-ACG265262
흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그FG60007-ACR265262
흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, C-Flag 태그FG60007-CF229893
흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, C-His 태그FG60007-CH229893
흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, C-Myc 태그FG60007-CM229893
흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, C-HA 태그FG60007-CY229893
흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone in cloning vectorFG60007-G88421
흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, C-His 태그FG60007-G-H229893
흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, N-Flag 태그FG60007-NF229893
흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, N-His 태그FG60007-NH229893
흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, N-Myc 태그FG60007-NM229893
흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, N-HA 태그FG60007-NY229893
흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmidFG60007-UT229893
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

IFN gamma, also known as IFNG, is a secreted protein which belongs to the type I I interferon family. IFN gamma is produced predominantly by natural killer and natural killer T cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte effector T cells once antigen-specific immunity develops. IFN gamma has antiviral, immunoregulatory, and anti-tumor properties. IFNG, in addition to having antiviral activity, has important immunoregulatory functions, it is a potent activator of macrophages, and has antiproliferative effects on transformed cells and it can potentiate the antiviral and antitumor effects of the type I interferons. The IFNG monomer consists of a core of six α-helices and an extended unfolded sequence in the C-terminal region. IFN gamma is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Aberrant IFN gamma expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFN gamma in the immune system stems in part from its ability to inhibit viral replication directly, and most importantly from its immunostimulatory and immunomodulatory effects. IFNG also promotes NK cell activity.

참고자료
  • Gray P W, et al. (1982) Structure of the human immune interferon gene. Nature. 298: 859-63.
  • Taya Y, et al. (1982) Cloning and structure of the human immune interferon-gamma chromosomal gene. EMBO J. 1: 953-8.
  • Goshima N, et al. (2008) Human protein factory for converting the transcriptome into an in vitro-expressed proteome. Nomura N Nat Methods. 5: 1011-7.
  • Thiel DJ, et al. (2000) Observation of an unexpected third receptor molecule in the crystal structure of human interferon-gamma receptor complex. Structure. 8 (9): 927-36.
  • Naylor SL, et al. (1983) Human immune interferon gene is located on chromosome 12. J Exp Med. 157 (3): 1020-7.
  • Schoenborn JR, et al. (2007) Regulation of interferon-gamma during innate and adaptive immune responses. Adv Immunol. 96: 41-101.
  • Size / Price
    Cat No: FG60007-NY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".