흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, N-HA 태그

    데이터시트리뷰관련제품프로토콜
    흰족제비 IFNG cDNA 클론 제품 정보
    Gene_bank_ref_id:AB300566.1
    cDNA 크기:501bp
    cDNA 설명:Full length Clone DNA of Ferret Interferon gamma with N terminal HA tag.
    유전자 동의어:IFNG
    :Ferret
    벡터:pCMV3-SP-N-HA
    Plasmid:
    제한 사이트:
    태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, N-HA 태그 on other vectors
    흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그FG60007-ACG265260
    흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그FG60007-ACR265260
    흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, C-Flag 태그FG60007-CF229890
    흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, C-His 태그FG60007-CH229890
    흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, C-Myc 태그FG60007-CM229890
    흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, C-HA 태그FG60007-CY229890
    흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone in cloning vectorFG60007-G88420
    흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, C-His 태그FG60007-G-H229890
    흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, N-Flag 태그FG60007-NF229890
    흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, N-His 태그FG60007-NH229890
    흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, N-Myc 태그FG60007-NM229890
    흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmid, N-HA 태그FG60007-NY229890
    흰족제비 Interferon Gamma/IFN gamma/IFNG Gene ORF cDNA clone expression plasmidFG60007-UT229890
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    연구배경

    IFN gamma, also known as IFNG, is a secreted protein which belongs to the type I I interferon family. IFN gamma is produced predominantly by natural killer and natural killer T cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte effector T cells once antigen-specific immunity develops. IFN gamma has antiviral, immunoregulatory, and anti-tumor properties. IFNG, in addition to having antiviral activity, has important immunoregulatory functions, it is a potent activator of macrophages, and has antiproliferative effects on transformed cells and it can potentiate the antiviral and antitumor effects of the type I interferons. The IFNG monomer consists of a core of six α-helices and an extended unfolded sequence in the C-terminal region. IFN gamma is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Aberrant IFN gamma expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFN gamma in the immune system stems in part from its ability to inhibit viral replication directly, and most importantly from its immunostimulatory and immunomodulatory effects. IFNG also promotes NK cell activity.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    참고자료
  • Gray P W, et al. (1982) Structure of the human immune interferon gene. Nature. 298: 859-63.
  • Taya Y, et al. (1982) Cloning and structure of the human immune interferon-gamma chromosomal gene. EMBO J. 1: 953-8.
  • Goshima N, et al. (2008) Human protein factory for converting the transcriptome into an in vitro-expressed proteome. Nomura N Nat Methods. 5: 1011-7.
  • Thiel DJ, et al. (2000) Observation of an unexpected third receptor molecule in the crystal structure of human interferon-gamma receptor complex. Structure. 8 (9): 927-36.
  • Naylor SL, et al. (1983) Human immune interferon gene is located on chromosome 12. J Exp Med. 157 (3): 1020-7.
  • Schoenborn JR, et al. (2007) Regulation of interferon-gamma during innate and adaptive immune responses. Adv Immunol. 96: 41-101.
  • Size / Price
    Cat No: FG60007-NY
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".