휴먼 HHIP Gene ORF cDNA clone expression plasmid, C-His 태그

  • Human HHIP Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
데이터시트리뷰관련제품프로토콜
휴먼 HHIP cDNA 클론 제품 정보
Gene_bank_ref_id:NM_022475.2
cDNA 크기:2103bp
cDNA 설명:Full length Clone DNA of Homo sapiens hedgehog interacting protein with His tag.
유전자 동의어:HIP, HHIP
:Human
벡터:pCMV/hygro-His
Plasmid:pCMV-HHIP-10his
제한 사이트:KpnI + XhoI (5.5kb + 2.13kb)
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:Identical with the Gene Bank Ref.ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with HHIP qPCR primers for gene expression analysis, HP102471 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
휴먼 HHIP Gene Plasmid Map
Human HHIP Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Cat No: HG13798-G-H
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보In Stock
장바구니에 추가대량 주문 문의

Datasheet & Documentation

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".