HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
HIV HIV-gag cDNA 클론 제품 정보
Gene_bank_ref_id:U51190.1
cDNA 크기:1500bp
cDNA 설명:Full length Clone DNA of HIV-1 (group M, subtype A, strain 92UG037.1) gag with N terminal His tag.
유전자 동의어:HIV-gag
:HIV
벡터:pCMV3-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-His 태그 on other vectors
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-GFPSpark 태그VG40241-ACG383160
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-OFPSpark / RFP 태그VG40241-ACR383160
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-GFPSpark 태그VG40241-ANG383160
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-OFPSpark / RFP 태그VG40241-ANR383160
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-Flag 태그VG40241-CF347790
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-His 태그VG40241-CH347790
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-Myc 태그VG40241-CM347790
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-HA 태그VG40241-CY347790
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid (Codon Optimized)VG40241-G112000
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-Flag 태그VG40241-NF347790
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-His 태그VG40241-NH347790
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-Myc 태그VG40241-NM347790
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-HA 태그VG40241-NY347790
HIV-1 (group M, subtype A, strain 92UG037.1) gag natural ORF mammalian expression plasmidVG40241-UT347790
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: VG40241-NH
정가: 
가격:      (You Save: )
Contact Us
이미지
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".