HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-HA 태그

    데이터시트리뷰관련제품프로토콜
    HIV HIV-gag cDNA 클론 제품 정보
    Gene_bank_ref_id:GQ324962.1
    cDNA 크기:1536bp
    cDNA 설명:Full length Clone DNA of HIV-1 (group N, strain 06CM-U14296) gag with C terminal HA tag.
    유전자 동의어:HIV-gag
    :HIV
    벡터:pCMV3-C-HA
    Plasmid:
    제한 사이트:
    태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at ambient temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-HA 태그 on other vectors
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-GFPSpark 태그VG40254-ACG406730
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-OFPSpark / RFP 태그VG40254-ACR406730
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-GFPSpark 태그VG40254-ANG406730
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-OFPSpark / RFP 태그VG40254-ANR406730
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-Flag 태그VG40254-CF371370
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-His 태그VG40254-CH371370
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-Myc 태그VG40254-CM371370
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-HA 태그VG40254-CY371370
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid (Codon Optimized)VG40254-G135580
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-Flag 태그VG40254-NF371370
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-His 태그VG40254-NH371370
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-Myc 태그VG40254-NM371370
    HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-HA 태그VG40254-NY371370
    HIV-1 (group N, strain 06CM-U14296) gag natural ORF mammalian expression plasmidVG40254-UT371370
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    Size / Price
    Cat No: VG40254-CY
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".