HIV-1 (group M, subtype A, strain 92UG037.1) env ORF mammalian expression plasmid, C-HA tag

Cat: VG40242-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HIV Envelope Reagents
CRO Services
Product recommended

All HIV Envelope Reagents
HIV-1 (group M, subtype A, strain 92UG037.1) env ORF mammalian expression plasmid, C-HA tag General Information
Gene
Species
HIV
NCBI Ref Seq
RefSeq ORF Size
2574 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of HIV-1 (group M, subtype A, strain 92UG037.1) env with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HIV Envelope Background Information

HIV Envelope cDNA ORF Clone, HIV, Related Products

Product Name Catalog#(PDF)
HIV-1 (group M, subtype A, strain 92UG037.1) env ORF mammalian expression plasmid (Codon Optimized) VG40242-G
HIV-1 (group N, strain 06CM-U14297) env ORF mammalian expression plasmid (Codon Optimized) VG40255-G
HIV-1 (group P, strain RBF168) env ORF mammalian expression plasmid (Codon Optimized) VG40259-G
HIV-1 (group M, subtype D, strain NDK) env ORF mammalian expression plasmid (Codon Optimized) VG40253-G
HIV-1 (group M, subtype C, strain 92BR025.8) env ORF mammalian expression plasmid (Codon Optimized) VG40251-G
HIV-1 (group M, subtype B, strain HXB2) env ORF mammalian expression plasmid (Codon Optimized) VG40248-G
HIV-1 (group N, strain 06CM-U14297) env natural ORF mammalian expression plasmid VG40255-UT
HIV-1 (group P, strain RBF168) env natural ORF mammalian expression plasmid VG40259-UT
HIV-1 (group M, subtype A, strain 92UG037.1) env natural ORF mammalian expression plasmid VG40242-UT
HIV-1 (group M, subtype B, strain HXB2) env natural ORF mammalian expression plasmid VG40248-UT
HIV-1 (group M, subtype C, strain 92BR025.8) env natural ORF mammalian expression plasmid VG40251-UT
HIV-1 (group M, subtype D, strain NDK) env natural ORF mammalian expression plasmid VG40253-UT
HIV-1 (group M, subtype B, strain HXB2) env Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40248-ACGLN
HIV-1 (group M, subtype D, strain NDK) env Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40253-ACGLN
HIV-1 (group M, subtype A, strain 92UG037.1) env ORF mammalian expression plasmid, C-GFPSpark tag VG40242-ACG
HIV-1 (group N, strain 06CM-U14297) env ORF mammalian expression plasmid, C-GFPSpark tag VG40255-ACG
HIV-1 (group M, subtype C, strain 92BR025.8) env Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40251-ACGLN
HIV-1 (group P, strain RBF168) env ORF mammalian expression plasmid, C-GFPSpark tag VG40259-ACG
HIV-1 (group M, subtype D, strain NDK) env ORF mammalian expression plasmid, C-GFPSpark tag VG40253-ACG
HIV-1 (group M, subtype C, strain 92BR025.8) env ORF mammalian expression plasmid, C-GFPSpark tag VG40251-ACG
HIV-1 (group N, strain 06CM-U14297) env Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40255-ACGLN
HIV-1 (group M, subtype A, strain 92UG037.1) env Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40242-ACGLN
HIV-1 (group P, strain RBF168) env Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40259-ACGLN
HIV-1 (group M, subtype B, strain HXB2) env ORF mammalian expression plasmid, C-GFPSpark tag VG40248-ACG
HIV-1 (group O, stain BCF06) env Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40257-ACGLN
HIV-1 (group M, subtype A, strain 92UG037.1) env ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40242-ACR
HIV-1 (group M, subtype D, strain NDK) env ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40253-ACR
HIV-1 (group N, strain 06CM-U14297) env ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40255-ACR
HIV-1 (group M, subtype B, strain HXB2) env ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40248-ACR
HIV-1 (group M, subtype C, strain 92BR025.8) env ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40251-ACR
HIV-1 (group P, strain RBF168) env ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40259-ACR
HIV-1 (group M, subtype B, strain HXB2) env ORF mammalian expression plasmid, C-Flag tag VG40248-CF
HIV-1 (group N, strain 06CM-U14297) env ORF mammalian expression plasmid, C-Flag tag VG40255-CF
HIV-1 (group M, subtype A, strain 92UG037.1) env ORF mammalian expression plasmid, C-Flag tag VG40242-CF
HIV-1 (group M, subtype D, strain NDK) env ORF mammalian expression plasmid, C-Flag tag VG40253-CF
HIV-1 (group P, strain RBF168) env ORF mammalian expression plasmid, C-Flag tag VG40259-CF
HIV-1 (group M, subtype C, strain 92BR025.8) env ORF mammalian expression plasmid, C-Flag tag VG40251-CF
HIV-1 (group M, subtype C, strain 92BR025.8) env ORF mammalian expression plasmid, N-Flag tag VG40251-NF
HIV-1 (group M, subtype B, strain HXB2) env ORF mammalian expression plasmid, N-Flag tag VG40248-NF
HIV-1 (group N, strain 06CM-U14297) env ORF mammalian expression plasmid, N-Flag tag VG40255-NF
HIV-1 (group M, subtype A, strain 92UG037.1) env ORF mammalian expression plasmid, N-Flag tag VG40242-NF
HIV-1 (group P, strain RBF168) env ORF mammalian expression plasmid, N-Flag tag VG40259-NF
HIV-1 (group M, subtype D, strain NDK) env ORF mammalian expression plasmid, N-Flag tag VG40253-NF
HIV-1 (group P, strain RBF168) env ORF mammalian expression plasmid, C-His tag VG40259-CH
HIV-1 (group N, strain 06CM-U14297) env ORF mammalian expression plasmid, C-His tag VG40255-CH
HIV-1 (group M, subtype B, strain HXB2) env ORF mammalian expression plasmid, C-His tag VG40248-CH
HIV-1 (group M, subtype C, strain 92BR025.8) env ORF mammalian expression plasmid, C-His tag VG40251-CH
HIV-1 (group M, subtype D, strain NDK) env ORF mammalian expression plasmid, C-His tag VG40253-CH
HIV-1 (group M, subtype A, strain 92UG037.1) env ORF mammalian expression plasmid, C-His tag VG40242-CH
HIV-1 (group M, subtype C, strain 92BR025.8) env ORF mammalian expression plasmid, N-His tag VG40251-NH
HIV-1 (group M, subtype D, strain NDK) env ORF mammalian expression plasmid, N-His tag VG40253-NH
HIV-1 (group P, strain RBF168) env ORF mammalian expression plasmid, N-His tag VG40259-NH
HIV-1 (group M, subtype A, strain 92UG037.1) env ORF mammalian expression plasmid, N-His tag VG40242-NH
HIV-1 (group N, strain 06CM-U14297) env ORF mammalian expression plasmid, N-His tag VG40255-NH
HIV-1 (group M, subtype B, strain HXB2) env ORF mammalian expression plasmid, N-His tag VG40248-NH
HIV-1 (group N, strain 06CM-U14297) env ORF mammalian expression plasmid, C-HA tag VG40255-CY
HIV-1 (group M, subtype D, strain NDK) env ORF mammalian expression plasmid, C-HA tag VG40253-CY
HIV-1 (group M, subtype B, strain HXB2) env ORF mammalian expression plasmid, C-HA tag VG40248-CY
HIV-1 (group P, strain RBF168) env ORF mammalian expression plasmid, C-HA tag VG40259-CY
HIV-1 (group M, subtype C, strain 92BR025.8) env ORF mammalian expression plasmid, C-HA tag VG40251-CY
HIV-1 (group M, subtype B, strain HXB2) env ORF mammalian expression plasmid, N-HA tag VG40248-NY
HIV-1 (group M, subtype C, strain 92BR025.8) env ORF mammalian expression plasmid, N-HA tag VG40251-NY
HIV-1 (group M, subtype A, strain 92UG037.1) env ORF mammalian expression plasmid, N-HA tag VG40242-NY
HIV-1 (group P, strain RBF168) env ORF mammalian expression plasmid, N-HA tag VG40259-NY
HIV-1 (group M, subtype D, strain NDK) env ORF mammalian expression plasmid, N-HA tag VG40253-NY
HIV-1 (group N, strain 06CM-U14297) env ORF mammalian expression plasmid, N-HA tag VG40255-NY
HIV-1 (group M, subtype B, strain HXB2) env ORF mammalian expression plasmid, C-Myc tag VG40248-CM
HIV-1 (group P, strain RBF168) env ORF mammalian expression plasmid, C-Myc tag VG40259-CM
HIV-1 (group M, subtype C, strain 92BR025.8) env ORF mammalian expression plasmid, C-Myc tag VG40251-CM
HIV-1 (group M, subtype A, strain 92UG037.1) env ORF mammalian expression plasmid, C-Myc tag VG40242-CM
HIV-1 (group M, subtype D, strain NDK) env ORF mammalian expression plasmid, C-Myc tag VG40253-CM
HIV-1 (group N, strain 06CM-U14297) env ORF mammalian expression plasmid, C-Myc tag VG40255-CM
HIV-1 (group M, subtype D, strain NDK) env ORF mammalian expression plasmid, N-Myc tag VG40253-NM
HIV-1 (group M, subtype A, strain 92UG037.1) env ORF mammalian expression plasmid, N-Myc tag VG40242-NM
HIV-1 (group P, strain RBF168) env ORF mammalian expression plasmid, N-Myc tag VG40259-NM
HIV-1 (group M, subtype C, strain 92BR025.8) env ORF mammalian expression plasmid, N-Myc tag VG40251-NM
HIV-1 (group N, strain 06CM-U14297) env ORF mammalian expression plasmid, N-Myc tag VG40255-NM
HIV-1 (group M, subtype B, strain HXB2) env ORF mammalian expression plasmid, N-Myc tag VG40248-NM
info info
添加购物车成功! 添加购物车失败!