After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-HA 태그

데이터시트리뷰관련제품프로토콜
HIV GP125 cDNA 클론 제품 정보
Gene_bank_ref_id:AB731740.1
cDNA 크기:1515bp
cDNA 설명:Full length Clone DNA of HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 (env 6682-8196bp) with C terminal HA tag.
유전자 동의어:GP125
:HIV
벡터:pCMV3-C-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-HA 태그 on other vectors
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-GFPSpark 태그VG40261-ACG406730
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-OFPSpark / RFP 태그VG40261-ACR406730
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-Flag 태그VG40261-CF371370
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-His 태그VG40261-CH371370
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-Myc 태그VG40261-CM371370
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-HA 태그VG40261-CY371370
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid (Codon Optimized)VG40261-G135580
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, N-Flag 태그VG40261-NF371370
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, N-His 태그VG40261-NH371370
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, N-Myc 태그VG40261-NM371370
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, N-HA 태그VG40261-NY371370
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 natural ORF mammalian expression plasmidVG40261-UT371370
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: VG40261-CY
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보2-3 weeks
대량 주문 문의장바구니에 추가
Contact Us
이미지
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".