휴먼 Acetoacetyl-CoA Synthetase Gene ORF cDNA clone expression plasmid, C-His 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 AACS cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_023928.3
    cDNA 크기:2019bp
    cDNA 설명:Full length Clone DNA of Homo sapiens acetoacetyl-CoA synthetase with C terminal His tag.
    유전자 동의어:ACSF1, SUR-5, FLJ12389, FLJ41251, AACS
    :Human
    벡터:pCMV3-C-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with AACS qPCR primers for gene expression analysis, HP101031 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    휴먼 Acetoacetyl-CoA Synthetase Gene ORF cDNA clone expression plasmid, C-His 태그 on other vectors
    휴먼 Acetoacetyl-CoA Synthetase Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG11117-ACG288840
    휴먼 Acetoacetyl-CoA Synthetase Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG11117-ACR288840
    휴먼 Acetoacetyl-CoA Synthetase Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG11117-ANG288840
    휴먼 Acetoacetyl-CoA Synthetase Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG11117-ANR288840
    휴먼 Acetoacetyl-CoA Synthetase Gene ORF cDNA clone expression plasmid, C-Flag 태그HG11117-CF253470
    휴먼 Acetoacetyl-CoA Synthetase Gene ORF cDNA clone expression plasmid, C-His 태그HG11117-CH253470
    휴먼 Acetoacetyl-CoA Synthetase Gene ORF cDNA clone expression plasmid, C-Myc 태그HG11117-CM253470
    휴먼 Acetoacetyl-CoA Synthetase Gene ORF cDNA clone expression plasmid, C-HA 태그HG11117-CY253470
    휴먼 Acetoacetyl-CoA Synthetase Gene ORF cDNA clone in cloning vectorHG11117-M88420
    휴먼 Acetoacetyl-CoA Synthetase Gene ORF cDNA clone expression plasmid, N-Flag 태그HG11117-NF253470
    휴먼 Acetoacetyl-CoA Synthetase Gene ORF cDNA clone expression plasmid, N-His 태그HG11117-NH253470
    휴먼 Acetoacetyl-CoA Synthetase Gene ORF cDNA clone expression plasmid, N-Myc 태그HG11117-NM253470
    휴먼 Acetoacetyl-CoA Synthetase Gene ORF cDNA clone expression plasmid, N-HA 태그HG11117-NY253470
    휴먼 Acetoacetyl-CoA Synthetase Gene ORF cDNA clone expression plasmidHG11117-UT253470
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    연구배경

    Acetoacetyl-CoA Synthetase (AACS) is a novel cytosolic ketone body (acetoacetate)-specific ligase. The AACS in adipose tissue plays an important role in utilizing ketone body for the fatty acid-synthesis during adipose tissue development. It had been improved that Acetoacetyl-CoA Synthetase is an essential enzyme for the synthesis of fatty acid and cholesterol from ketone bodies, was found to be highly expressed in mouse adipose tissue, and GC box and C/EBPs motif were crucial for AACS promoter activity in 3T3-L1 adipocytes. Moreover, AACS promoter activity was controlled mainly by C/EBPalpha during adipogenesis. AACS gene expression is particularly abundant in white adipose tissue, as it is induced during adipocyte differentiation. The human AACS promoter is a PPARgamma target gene and that this nuclear receptor is recruited to the AACS promoter by direct interaction with Sp1 (stimulating protein-1). The Acetoacetyl-CoA Synthetase has important roles in the regulation of ketone body utilization in rat liver and that these hypocholesterolemic agents have the ability to remedy the impaired utilization of ketone bodies under the diabetic condition.

    참고자료
  • Aguil F, et al. (2010) Transcriptional regulation of the human acetoacetyl-CoA synthetase gene by PPARgamma. Biochem J. 427(2): 255-64.
  • Hasegawa S, et al. (2008) Transcriptional regulation of ketone body-utilizing enzyme, acetoacetyl-CoA synthetase, by C/EBPalpha during adipocyte differentiation. Biochim Biophys Acta. 1779(6-7): 414-9.
  • Sato H, et al. (2002) Effects of streptozotocin-induced diabetes on acetoacetyl-CoA synthetase activity in rats. Biochem Pharmacol. 63(10): 1851-5.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".