휴먼 ABCB1 Gene ORF cDNA clone expression plasmid

  • Human ABCB1 natural ORF mammalian expression plasmid
데이터시트리뷰관련제품프로토콜
휴먼 ABCB1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000927
cDNA 크기:3843bp
cDNA 설명:Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 1.
유전자 동의어:P-gp, CD243, GP170, ABC20
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-ABCB1
제한 사이트:KpnI (two restriction sites) + XbaI (6.1kb + 2.82kb + 1.07kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 3435T>C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ABCB1 qPCR primers for gene expression analysis, HP101566 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
휴먼 ABCB1 Gene Plasmid Map
Human ABCB1 natural ORF mammalian expression plasmid
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".