ABRACL cDNA ORF Clone, Human, C-OFPSpark® tag

Price:
Size:
Number:

ABRACL cDNA ORF Clone, Human, C-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
246 bp
Description
Full length Clone DNA of Human ABRA C-terminal like with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About ABRACL

Entrez Gene ID

ABRACL cDNA ORF Clone, Human, C-OFPSpark® tag: Alternative Names

C6orf115 cDNA ORF Clone, Human; Costars cDNA ORF Clone, Human; HSPC280 cDNA ORF Clone, Human; PRO2013 cDNA ORF Clone, Human

ABRACL Background Information

Full Name
ABRA C-terminal like
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait