휴먼 ACBD6 Gene ORF cDNA clone expression plasmid, C-His 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 ACBD6 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_032360.2
    cDNA 크기:849bp
    cDNA 설명:Full length Clone DNA of Homo sapiens acyl-Coenzyme A binding domain containing 6 with C terminal His tag.
    유전자 동의어:MGC2404, ACBD6
    :Human
    벡터:pCMV3-C-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ACBD6 qPCR primers for gene expression analysis, HP101027 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    연구배경

    Acyl-coenzyme A binding domain-containing member 6 (ACBD6) is a modular protein that carries an acyl-CoA binding domain at its N terminus and two ankyrin motifs at its C terminus. In mammals, there are six members of the acyl-CoA binding domain-containing (ACBD) family, and their annotation is not uniform. All six ACBD proteins contain an ACB domain at the N terminus, but they do not share significant homology at the C-terminal region. ACBD6 is a 32 kDa protein that is predicted by sequence analysis to carry an ACB domain between residues 42 and 125 and two ANK motifs at its C terminus. This protein binds long-chain acyl-CoAs with a strong preference for unsaturated, C18:1-CoA and C20:4-CoA, over saturated, C16:0-CoA, acyl species. ACBD6 is not a ubiquitous protein, but it is expressed in hematopoietic tissues and appears to be restricted to primitive stem cells present in those tissues with functions in blood and vessel development. ACBD6 was detected in bone marrow, spleen, placenta, cord blood, circulating CD34+ progenitors, and embryonic-like stem cells derived from placenta. In placenta, the protein was only detected in CD34+ progenitor cells present in blood and in CD31+ endothelial cells surrounding the blood vessels. These cells were also positive for the marker CD133, and they probably constitute hemangiogenic stem cells, precursors of both blood and vessels. We propose that human ACBD6 represents a cellular marker for primitive progenitor cells with functions in hematopoiesis and vascular endothelium development.

    참고자료
  • Soupene E, et al. (2008) Characterization of an acyl-coenzyme A binding protein predominantly expressed in human primitive progenitor cells. J Lipid Res. 49(5): 1103-12.
  • Size / Price
    Cat No: HG11112-CH
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".