휴먼 ACE2 / Angiotensin-Converting Enzyme 2 Gene ORF cDNA clone expression plasmid, N-His 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 ACE2 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_021804.1
    cDNA 크기:2418bp
    cDNA 설명:Full length Clone DNA of Homo sapiens angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 with N terminal His tag.
    유전자 동의어:ACE2, ACEH, DKFZP434A014
    :Human
    벡터:pCMV3-SP-N-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ACE2 qPCR primers for gene expression analysis, HP100185 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    휴먼 ACE2 / Angiotensin-Converting Enzyme 2 Gene ORF cDNA clone expression plasmid, N-His 태그 on other vectors
    Product nameProduct name
    연구배경

    Angiotensin-converting enzyme 2 (ACE2), a first homolog of ACE, regulates the renin angiotensin system (RAS) by counterbalancing ACE activity. Accumulating evidence in recent years has demonstrated a physiological and pathological role of ACE2 in the cardiovascular, renal and respiratory systems. ACE2 also has an important role in blood pressure control. This enzyme, an homolog of ACE, hydrolyzes angiotensin (Ang) I to produce Ang-(1-9), which is subsequently converted into Ang-(1-7) by a neutral endopeptidase and ACE. ACE2 releases Ang-(1-7) more efficiently than its catalysis of Ang-(1-9) by cleavage of Pro(7)-Phe(8) bound in Ang II. Thus, the major biologically active product of ACE2 is Ang-(1-7), which is considered to be a beneficial peptide of the RAS cascade in the cardiovascular system. A physiological role for ACE2 has been implicated in hypertension, cardiac function, heart function and diabetes, and as a receptor of the severe acute respiratory syndrome coronavirus. In the acute respiratory distress syndrome (ARDS), ACE, AngII, and AT1R promote the disease pathogenesis, whereas ACE2 and the AT2R protect from ARDS. Importantly, ACE2 has been identified as a key SARS-coronavirus receptor and plays a protective role in severe acute respiratory syndrome (SARS) pathogenesis. Furthermore, the recent explosion of research into the ACE2 homolog, collectrin, has revealed a new physiological function of ACE2 as an amino acid transporter, which explains the pathogenic role of gene mutations in Hartnup disorder. This review summarizes and discusses the recently unveiled roles for ACE2 in disease pathogenesis.

    참고자료
  • Koitka A, et al. (2008) Angiotensin converting enzyme 2 in the kidney. Clin Exp Pharmacol Physiol. 35(4): 420-5.
  • Raizada MK, et al. (2007) ACE2: a new target for cardiovascular disease therapeutics. J Cardiovasc Pharmacol. 50(2): 112-9.
  • Imai Y, et al. (2007) Angiotensin-converting enzyme 2 (ACE2) in disease pathogenesis. Circ J. 74(3): 405-10.
  • Turner AJ, et al. (2004) ACE2: from vasopeptidase to SARS virus receptor. Trends Pharmacol Sci. 25(6): 291-4.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".