휴먼 Acyl-CoA Thioesterase 9 Gene ORF cDNA clone expression plasmid

    데이터시트리뷰관련제품프로토콜
    휴먼 ACOT9 cDNA 클론 제품 정보
    Gene_bank_ref_id:BC012573
    cDNA 크기:639bp
    cDNA 설명:Full length Clone DNA of Homo sapiens acyl-CoA thioesterase 9.
    유전자 동의어:CGI-16, ACATE2, MT-ACT48, MTACT48, ACOT9
    :Human
    벡터:pCMV3-untagged
    Plasmid:
    제한 사이트:
    태그 씨퀀스:
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ACOT9 qPCR primers for gene expression analysis, HP102884 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    휴먼 Acyl-CoA Thioesterase 9 Gene ORF cDNA clone expression plasmid on other vectors
    휴먼 Acyl-CoA Thioesterase 9 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG14234-ACG265260
    휴먼 Acyl-CoA Thioesterase 9 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG14234-ACR265260
    휴먼 Acyl-CoA Thioesterase 9 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG14234-ANG265260
    휴먼 Acyl-CoA Thioesterase 9 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG14234-ANR265260
    휴먼 Acyl-CoA Thioesterase 9 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG14234-CF229890
    휴먼 Acyl-CoA Thioesterase 9 Gene ORF cDNA clone expression plasmid, C-His 태그HG14234-CH229890
    휴먼 Acyl-CoA Thioesterase 9 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG14234-CM229890
    휴먼 Acyl-CoA Thioesterase 9 Gene ORF cDNA clone expression plasmid, C-HA 태그HG14234-CY229890
    휴먼 Acyl-CoA Thioesterase 9 Gene ORF cDNA clone in cloning vectorHG14234-G88420
    휴먼 Acyl-CoA Thioesterase 9 Gene ORF cDNA clone expression plasmidHG14234-G-N229890
    휴먼 Acyl-CoA Thioesterase 9 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG14234-NF229890
    휴먼 Acyl-CoA Thioesterase 9 Gene ORF cDNA clone expression plasmid, N-His 태그HG14234-NH229890
    휴먼 Acyl-CoA Thioesterase 9 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG14234-NM229890
    휴먼 Acyl-CoA Thioesterase 9 Gene ORF cDNA clone expression plasmid, N-HA 태그HG14234-NY229890
    휴먼 Acyl-CoA Thioesterase 9 Gene ORF cDNA clone expression plasmidHG14234-UT229890
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    Size / Price
    Cat No: HG14234-UT
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".