After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 Actin-like 단백질 6A/BAF53a Gene ORF cDNA clone expression plasmid, C-Flag 태그

데이터시트리뷰관련제품프로토콜
Human ACTL6A cDNA 클론 제품 정보
Gene_bank_ref_id:NM_004301.3
cDNA 크기:1290bp
cDNA 설명:Full length Clone DNA of Homo sapiens actin-like 6A with C terminal Flag tag.
유전자 동의어:Arp4, ACTL6, BAF53A, INO80K, MGC5382
:Human
벡터:pCMV3-C-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

휴먼 Actin-like 단백질 6A/BAF53a Gene ORF cDNA clone expression plasmid, C-Flag 태그 on other vectors
휴먼 Actin-like 단백질 6A/BAF53a Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10963-ACG265260
휴먼 Actin-like 단백질 6A/BAF53a Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10963-ACR265260
휴먼 Actin-like 단백질 6A/BAF53a Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG10963-ANG265260
휴먼 Actin-like 단백질 6A/BAF53a Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG10963-ANR265260
휴먼 Actin-like 단백질 6A/BAF53a Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10963-CF229890
휴먼 Actin-like 단백질 6A/BAF53a Gene ORF cDNA clone expression plasmid, C-His 태그HG10963-CH229890
휴먼 Actin-like 단백질 6A/BAF53a Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10963-CM229890
휴먼 Actin-like 단백질 6A/BAF53a Gene ORF cDNA clone expression plasmid, C-HA 태그HG10963-CY229890
휴먼 Actin-like 단백질 6A/BAF53a Gene ORF cDNA clone in cloning vectorHG10963-M88420
휴먼 Actin-like 단백질 6A/BAF53a Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10963-M-F229890
휴먼 Actin-like 단백질 6A/BAF53a Gene ORF cDNA clone expression plasmidHG10963-M-N229890
휴먼 Actin-like 단백질 6A/BAF53a Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10963-NF229890
휴먼 Actin-like 단백질 6A/BAF53a Gene ORF cDNA clone expression plasmid, N-His 태그HG10963-NH229890
휴먼 Actin-like 단백질 6A/BAF53a Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10963-NM229890
휴먼 Actin-like 단백질 6A/BAF53a Gene ORF cDNA clone expression plasmid, N-HA 태그HG10963-NY229890
휴먼 Actin-like 단백질 6A/BAF53a Gene ORF cDNA clone expression plasmidHG10963-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: HG10963-CF
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보2-3 weeks
대량 주문 문의장바구니에 추가
Contact Us
이미지
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".