alpha Actinin 4/ACTN4 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10971-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All alpha Actinin 4/ACTN4 Reagents

CRO Services

Product recommended


All alpha Actinin 4/ACTN4 Reagents

alpha Actinin 4/ACTN4 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2775 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human actinin, alpha 4 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+2.78kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

alpha Actinin 4/ACTN4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

alpha Actinin 4/ACTN4 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5609

alpha Actinin 4/ACTN4 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

ACTININ-4 cDNA ORF Clone, Human;FSGS cDNA ORF Clone, Human;FSGS1 cDNA ORF Clone, Human

alpha Actinin 4/ACTN4 Background Information

Actinin, alpha 4 (ACTN4), a nonmuscle cytoskeleton protein, has been frequently reported to be associated with cell motility and cancer metastasis. Honda et al. have suggested that cytoplasmic ACTN4 increases cell motility and is associated with a high metastatic potential and a poor prognosis of cancer based on their studies on multiple cancer cell lines. Since then, ACTN4 has been reported to be associated with the progression and metastasis of many types of cancer, including breast, colorectal, pancreatic, lung, brain, bladder, and ovarian cancers and salivary gland carcinoma.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
actinin, alpha 4
References
  • Gao Y, Li G, Sun L, et al. ACTN4 and the pathways associated with cell motility and adhesion contribute to the process of lung cancer metastasis to the brain. BMC Cancer. 2015;15:277.
  • Fukumoto M, Kurisu S, Yamada T, Takenawa T. α-Actinin-4 Enhances Colorectal Cancer Cell Invasion by Suppressing Focal Adhesion Maturation. St-Pierre Y, ed. PLoS ONE. 2015;10(4):e0120616.
  • info info
    添加购物车成功! 添加购物车失败!