휴먼 Aminoacylase-1/ACY1 Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
휴먼 ACY1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000666.1
cDNA 크기:1227bp
cDNA 설명:Full length Clone DNA of Homo sapiens aminoacylase 1 with N terminal Flag tag.
유전자 동의어:ACY1D, ACYLASE
:Human
벡터:pCMV3-N-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ACY1 qPCR primers for gene expression analysis, HP100038 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

휴먼 Aminoacylase-1/ACY1 Gene ORF cDNA clone expression plasmid, N-Flag 태그 on other vectors
휴먼 Aminoacylase-1/ACY1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10549-ACG265260
휴먼 Aminoacylase-1/ACY1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10549-ACR265260
휴먼 Aminoacylase-1/ACY1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG10549-ANG265260
휴먼 Aminoacylase-1/ACY1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG10549-ANR265260
휴먼 Aminoacylase-1/ACY1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10549-CF229890
휴먼 Aminoacylase-1/ACY1 Gene ORF cDNA clone expression plasmid, C-His 태그HG10549-CH229890
휴먼 Aminoacylase-1/ACY1 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10549-CM229890
휴먼 Aminoacylase-1/ACY1 Gene ORF cDNA clone expression plasmid, C-HA 태그HG10549-CY229890
휴먼 Aminoacylase-1/ACY1 Gene ORF cDNA clone in cloning vectorHG10549-M88420
휴먼 Aminoacylase-1/ACY1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10549-M-F229890
휴먼 Aminoacylase-1/ACY1 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10549-NF229890
휴먼 Aminoacylase-1/ACY1 Gene ORF cDNA clone expression plasmid, N-His 태그HG10549-NH229890
휴먼 Aminoacylase-1/ACY1 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10549-NM229890
휴먼 Aminoacylase-1/ACY1 Gene ORF cDNA clone expression plasmid, N-HA 태그HG10549-NY229890
휴먼 Aminoacylase-1/ACY1 Gene ORF cDNA clone expression plasmidHG10549-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Aminoacylase 1 (ACY1), a metalloenzyme that removes amide-linked ACY1 groups from amino acids and may play a role in regulating responses to oxidative stress. Both the C-terminal fragment found in the two-hybrid screen and full-length ACY1 co-immunoprecipitate with SphK1. Though both C-terminal and full-length proteins slightly reduce SphK1 activity measured in vitro, the C-terminal fragment inhibits while full-length ACY1 potentiates the effects of SphK1 on proliferation and apoptosis. It suggested that ACY1 physically interacts with SphK1 and may influence its physiological functions. As a homodimeric zinc-binding enzyme, Aminoacylase 1 catalyzes the hydrolysis of N alpha-acylated amino acids. Deficiency of Aminoacylase 1 due to mutations in the Aminoacylase 1 (ACY1) gene follows an autosomal-recessive trait of inheritance and is characterized by accumulation of N-acetyl amino acids in the urine.

참고자료
  • Sommer A, et al. (2011) The molecular basis of aminoacylase 1 deficiency. Biochim Biophys Acta. 1812(6): 685-90.
  • Maceyka M, et al. (2004) Aminoacylase 1 is a sphingosine kinase 1-interacting protein. FEBS Lett. 568(1-3): 30-4.
  • Cook RM, et al.(1993) Human aminoacylase-1. Cloning, sequence, and expression analysis of a chromosome 3p21 gene inactivated in small cell lung cancer. J Biol Chem. 268(23): 17010-7.
  • Size / Price
    Cat No: HG10549-NF
    정가: 
    가격:      (You Save: )
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".