ADCK1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10792-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ADCK1 Reagents

CRO Services

Product recommended


All ADCK1 Reagents

ADCK1 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1571 bp
Description
Full length Clone DNA of Human aarF domain containing kinase 1 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ADCK1 Background Information

Full Name
aarF domain containing kinase 1

ADCK1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ADCK1 cDNA ORF Clone in Cloning Vector, Mouse MG51025-G
ADCK1 cDNA ORF Clone, Mouse, untagged MG51025-UT
ADCK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51025-ACGLN
ADCK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51025-ACG
ADCK1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51025-ANG
ADCK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51025-ACR
ADCK1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51025-ANR
ADCK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51025-CF
ADCK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51025-NF
ADCK1 cDNA ORF Clone, Mouse, C-His tag MG51025-CH
ADCK1 cDNA ORF Clone, Mouse, N-His tag MG51025-NH
ADCK1 cDNA ORF Clone, Mouse, C-HA tag MG51025-CY
ADCK1 cDNA ORF Clone, Mouse, N-HA tag MG51025-NY
ADCK1 cDNA ORF Clone, Mouse, C-Myc tag MG51025-CM
ADCK1 cDNA ORF Clone, Mouse, N-Myc tag MG51025-NM
ADCK1 qPCR Primer Pairs, Mouse MP200984

ADCK1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ADCK1 cDNA ORF Clone in Cloning Vector, Human HG10792-G
ADCK1 cDNA ORF Clone, Human, untagged HG10792-UT
ADCK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10792-ACG
ADCK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10792-ACGLN
ADCK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10792-ACR
ADCK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10792-CF
ADCK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10792-NF
ADCK1 cDNA ORF Clone, Human, C-His tag HG10792-CH
ADCK1 cDNA ORF Clone, Human, N-His tag HG10792-NH
ADCK1 cDNA ORF Clone, Human, C-HA tag HG10792-CY
ADCK1 cDNA ORF Clone, Human, N-HA tag HG10792-NY
ADCK1 cDNA ORF Clone, Human, C-Myc tag HG10792-CM
ADCK1 qPCR Primer Pairs, Human HP100706
info info
添加购物车成功! 添加购物车失败!