After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 Adrenomedullin / ADM Gene ORF cDNA clone expression plasmid, C-Flag 태그

데이터시트리뷰관련제품프로토콜
Human ADM cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001124.1
cDNA 크기:558bp
cDNA 설명:Full length Clone DNA of Homo sapiens adrenomedullin with C terminal Flag tag.
유전자 동의어:AM, ADM
:Human
벡터:pCMV3-C-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Adrenomedullin consists of 52 amino acids and is a member of the adrenomedullin family. It s a a hypotensive peptide and has 1 intramolecular disulfide bond. It seems that adrenomedullin has a slight homology with the calcitonin gene-related peptide. Adrenomedullin has a highly expression in pheochromocytoma and adrenal medulla. It also can be detected in lung, ventricle and kidney tissues. Adrenomedullin and PAMP are potent hypotensive and vasodilatator agents. Numerous actions have been reported most related to the physiologic control of fluid and electrolyte homeostasis. In the kidney, adrenomedullin is diuretic and natriuretic, and both adrenomedullin and PAMP inhibit aldosterone secretion by direct adrenal actions. In pituitary gland, both peptides at physiologically relevant doses inhibit basal ACTH secretion. Both peptides appear to act in brain and pituitary gland to facilitate the loss of plasma volume, actions which complement their hypotensive effects in blood vessels. It is believed that adrenomedullin functions through combinations of the calcitonin receptor like receptor and receptor activity-modifying proteins complexes, as well as CGRP receptors.

참고자료
  • Hao SL, et al. (2011) The antifibrosis effect of adrenomedullin in human lung fibroblasts. Exp Lung Res. 37(10):615-26.
  • Hikosaka T, et al. (2011) Adrenomedullin production is increased in colorectal adenocarcinomas; its relation to matrix metalloproteinase-9. Peptides. 32(9):1825-31.
  • Boc-Zalewska A, et al. (2011) Adrenomedullin mRNA expression in placenta of preeclamptic women. Ginekol Pol. 82(8):585-91.
  • Palladini G, et al. (2011) Midregional proadrenomedullin (MR-proADM) is a powerful predictor of early death in AL amyloidosis. Amyloid. 18(4):216-21.
  • Size / Price
    Cat No: HG11646-CF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".