ADPRH cDNA ORF Clone, Human, N-His tag

Cat: HG15393-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ADPRH Reagents
CRO Services
Product recommended

All ADPRH Reagents
ADPRH cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1074 bp
Description
Full length Clone DNA of Human ADP-ribosylarginine hydrolase with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ADPRH cDNA ORF Clone, Human, N-His tag Alternative Names
ARH1 cDNA ORF Clone, Human
ADPRH Background Information
Full Name
ADP-ribosylarginine hydrolase

ADPRH cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ADPRH cDNA ORF Clone in Cloning Vector, Mouse MG51584-G
ADPRH cDNA ORF Clone, Mouse, untagged MG51584-UT
ADPRH Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51584-ACGLN
ADPRH cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51584-ACG
ADPRH cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51584-ANG
ADPRH cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51584-ACR
ADPRH cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51584-ANR
ADPRH cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51584-CF
ADPRH cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51584-NF
ADPRH cDNA ORF Clone, Mouse, C-His tag MG51584-CH
ADPRH cDNA ORF Clone, Mouse, N-His tag MG51584-NH
ADPRH cDNA ORF Clone, Mouse, C-HA tag MG51584-CY
ADPRH cDNA ORF Clone, Mouse, N-HA tag MG51584-NY
ADPRH cDNA ORF Clone, Mouse, C-Myc tag MG51584-CM
ADPRH cDNA ORF Clone, Mouse, N-Myc tag MG51584-NM
ADPRH qPCR Primer Pairs, Mouse MP201467

ADPRH cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ADPRH cDNA ORF Clone in Cloning Vector, Human HG15393-G
ADPRH cDNA ORF Clone, Human, untagged HG15393-UT
ADPRH Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15393-ACGLN
ADPRH cDNA ORF Clone, Human, C-GFPSpark® tag HG15393-ACG
ADPRH cDNA ORF Clone, Human, N-GFPSpark® tag HG15393-ANG
ADPRH cDNA ORF Clone, Human, C-OFPSpark® tag HG15393-ACR
ADPRH cDNA ORF Clone, Human, N-OFPSpark® tag HG15393-ANR
ADPRH cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15393-CF
ADPRH cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15393-NF
ADPRH cDNA ORF Clone, Human, C-His tag HG15393-CH
ADPRH cDNA ORF Clone, Human, C-HA tag HG15393-CY
ADPRH cDNA ORF Clone, Human, N-HA tag HG15393-NY
ADPRH cDNA ORF Clone, Human, C-Myc tag HG15393-CM
ADPRH cDNA ORF Clone, Human, N-Myc tag HG15393-NM
ADPRH qPCR Primer Pairs, Human HP104017
info info
添加购物车成功! 添加购物车失败!