AGPAT2/LPAAT-beta cDNA ORF Clone, Human, untagged

Cat: HG14250-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AGPAT2/LPAAT-beta Reagents
CRO Services
Product recommended

All AGPAT2/LPAAT-beta Reagents
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
840 bp
Description
Full length Clone DNA of Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AGPAT2/LPAAT-beta cDNA ORF Clone, Human, untagged Alternative Names
1-AGPAT2 cDNA ORF Clone, Human;BSCL cDNA ORF Clone, Human;BSCL1 cDNA ORF Clone, Human;LPAAB cDNA ORF Clone, Human;LPAAT-beta cDNA ORF Clone, Human
AGPAT2/LPAAT-beta Background Information
Full Name
1-acylglycerol-3-phosphate O-acyltransferase 2

AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
AGPAT2/LPAAT-beta cDNA ORF Clone in Cloning Vector, Rat RG80533-U
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, untagged RG80533-UT
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, C-GFPSpark® tag RG80533-ACG
AGPAT2/LPAAT-beta Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80533-ACGLN
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, C-OFPSpark® tag RG80533-ACR
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80533-CF
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80533-NF
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, C-His tag RG80533-CH
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, N-His tag RG80533-NH
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, C-HA tag RG80533-CY
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, N-HA tag RG80533-NY
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, C-Myc tag RG80533-CM
AGPAT2/LPAAT-beta cDNA ORF Clone, Rat, N-Myc tag RG80533-NM
AGPAT2/LPAAT-beta qPCR Primer Pairs, Rat RP300497

AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AGPAT2/LPAAT-beta cDNA ORF Clone in Cloning Vector, Mouse MG53399-U
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, untagged MG53399-UT
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53399-ACG
AGPAT2/LPAAT-beta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53399-ACGLN
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53399-ACR
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53399-CF
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53399-NF
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, C-His tag MG53399-CH
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, N-His tag MG53399-NH
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, C-HA tag MG53399-CY
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, N-HA tag MG53399-NY
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, C-Myc tag MG53399-CM
AGPAT2/LPAAT-beta cDNA ORF Clone, Mouse, N-Myc tag MG53399-NM

AGPAT2/LPAAT-beta cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AGPAT2/LPAAT-beta cDNA ORF Clone in Cloning Vector, Human HG14250-G
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, C-GFPSpark® tag HG14250-ACG
AGPAT2/LPAAT-beta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14250-ACGLN
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, C-OFPSpark® tag HG14250-ACR
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14250-CF
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14250-NF
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, C-His tag HG14250-CH
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, N-His tag HG14250-NH
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, C-HA tag HG14250-CY
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, N-HA tag HG14250-NY
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, C-Myc tag HG14250-CM
AGPAT2/LPAAT-beta cDNA ORF Clone, Human, N-Myc tag HG14250-NM
AGPAT2/LPAAT-beta qPCR Primer Pairs, Human HP102900
info info
添加购物车成功! 添加购物车失败!