휴먼 IBA1/AIF1 Gene ORF cDNA clone expression plasmid

  • Human AIF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
데이터시트리뷰관련제품프로토콜
휴먼 AIF1 cDNA 클론 제품 정보
Gene_bank_ref_id:BC009474
cDNA 크기:444bp
cDNA 설명:Full length Clone DNA of Homo sapiens allograft inflammatory factor 1.
유전자 동의어:DADB-70P7.8, AIF-1, IBA1, IRT-1, IRT1, AIF1
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-AIF1
제한 사이트:KpnI + XbaI (6.1kb + 0.44kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with AIF1 qPCR primers for gene expression analysis, HP102877 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
휴먼 AIF1 Gene Plasmid Map
Human AIF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
연구배경

AIF1, also known as IBA1, is an actin-binding protein. AIF1 is expressed selectively in human macrophage-like cell lines, and in a subset of CD68(+) macrophages in the interstitial and perivascular spaces of human heart allografts. It is expressed in macrophages and neutrophils. AIF1 enhances membrane ruffling and RAC activation. AIF1 enhances the actin-bundling activity of LCP1. It also enhances lymphocyte migration. AIF1 may play a role in macrophage activation and function. It binds calcium and plays a role in RAC signaling and in phagocytosis. It promotes the proliferation of vascular smooth muscle cells and of T-lymphocytes.

Size / Price
Cat No: HG14227-UT
정가: 
가격:      (You Save: )

Datasheet & Documentation

Contact Us
    최근에 조회한 품목
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".