After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 AK4 / Adenylate Kinase 4 / AK3L1 Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Human AK4 cDNA 클론 제품 정보
Gene_bank_ref_id:BC016180
cDNA 크기:672bp
cDNA 설명:Full length Clone DNA of Homo sapiens adenylate kinase 4 with N terminal His tag.
유전자 동의어:AK3, AK3L1, AK3L2
:Human
벡터:pCMV3-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

휴먼 AK4 / Adenylate Kinase 4 / AK3L1 Gene ORF cDNA clone expression plasmid, N-His 태그 on other vectors
휴먼 AK4 / Adenylate Kinase 4 / AK3L1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG12406-ACG265260
휴먼 AK4 / Adenylate Kinase 4 / AK3L1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG12406-ACR265260
휴먼 AK4 / Adenylate Kinase 4 / AK3L1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG12406-ANG265260
휴먼 AK4 / Adenylate Kinase 4 / AK3L1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG12406-ANR265260
휴먼 AK4 / Adenylate Kinase 4 / AK3L1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG12406-CF229890
휴먼 AK4 / Adenylate Kinase 4 / AK3L1 Gene ORF cDNA clone expression plasmid, C-His 태그HG12406-CH229890
휴먼 AK4 / Adenylate Kinase 4 / AK3L1 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG12406-CM229890
휴먼 AK4 / Adenylate Kinase 4 / AK3L1 Gene ORF cDNA clone expression plasmid, C-HA 태그HG12406-CY229890
휴먼 AK4 / Adenylate Kinase 4 / AK3L1 Gene ORF cDNA clone in cloning vectorHG12406-G88420
휴먼 AK4 / Adenylate Kinase 4 / AK3L1 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG12406-NF229890
휴먼 AK4 / Adenylate Kinase 4 / AK3L1 Gene ORF cDNA clone expression plasmid, N-His 태그HG12406-NH229890
휴먼 AK4 / Adenylate Kinase 4 / AK3L1 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG12406-NM229890
휴먼 AK4 / Adenylate Kinase 4 / AK3L1 Gene ORF cDNA clone expression plasmid, N-HA 태그HG12406-NY229890
휴먼 AK4 / Adenylate Kinase 4 / AK3L1 Gene ORF cDNA clone expression plasmidHG12406-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Adenylate kinase isoenzyme 4, mitochondrial, also known as ATP-AMP transphosphorylase, Adenylate kinase 3-like, AK4 and AK3L1, is a member the adenylate kinase family. AK4 / AK3L1 is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. AK4 / AK3L1 catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP. It may also be active with GTP. Adenylate kinase 4 ( AK4 / AK3L1 ) is a unique member with no enzymatic activity in the adenylate kinase (AK) family although it shares high sequence homology with other AKs. It remains unclear what physiological function AK4 might play or why it is enzymatically inactive. AK4 / AK3L1 retains the capability of binding nucleotides. It has a glutamine residue instead of a key arginine residue in the active site well conserved in other AKs. The enzymatically inactive AK4 is a stress responsive protein critical to cell survival and proliferation. AK4 / AK3L1 is likely that the interaction with the mitochondrial inner membrane protein ANT is important for AK4 to exert the protective benefits to cells under stress. AK4 / AK3L1 also acts on the specific mechanism of energy metabolism rather than control of the homeostasis of the ADP pool ubiquitously.

Size / Price
Cat No: HG12406-NH
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보2-3 weeks
대량 주문 문의장바구니에 추가
Contact Us
이미지
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".