AKT1S1/PRAS40 cDNA ORF Clone, Human, N-His tag

Cat: HG10092-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All AKT1S1/PRAS40 Reagents
CRO Services
Product recommended

All AKT1S1/PRAS40 Reagents
AKT1S1/PRAS40 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
771 bp
Description
Full length Clone DNA of Human AKT1 substrate 1 (proline-rich), transcript variant 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AKT1S1/PRAS40 cDNA ORF Clone, Human, N-His tag Alternative Names
Lobe cDNA ORF Clone, Human;PRAS40 cDNA ORF Clone, Human
AKT1S1/PRAS40 Background Information
Full Name
AKT1 substrate 1 (proline-rich)

AKT1S1/PRAS40 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
AKT1S1/PRAS40 cDNA ORF Clone in Cloning Vector, Rat RG81610-G
AKT1S1/PRAS40 cDNA ORF Clone, Rat, untagged RG81610-UT
AKT1S1/PRAS40 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81610-ACG
AKT1S1/PRAS40 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81610-ACGLN
AKT1S1/PRAS40 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81610-ANG
AKT1S1/PRAS40 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81610-ACR
AKT1S1/PRAS40 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81610-ANR
AKT1S1/PRAS40 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81610-CF
AKT1S1/PRAS40 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81610-NF
AKT1S1/PRAS40 cDNA ORF Clone, Rat, C-His tag RG81610-CH
AKT1S1/PRAS40 cDNA ORF Clone, Rat, N-His tag RG81610-NH
AKT1S1/PRAS40 cDNA ORF Clone, Rat, C-HA tag RG81610-CY
AKT1S1/PRAS40 cDNA ORF Clone, Rat, N-HA tag RG81610-NY
AKT1S1/PRAS40 cDNA ORF Clone, Rat, C-Myc tag RG81610-CM
AKT1S1/PRAS40 cDNA ORF Clone, Rat, N-Myc tag RG81610-NM

AKT1S1/PRAS40 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AKT1S1/PRAS40 cDNA ORF Clone in Cloning Vector, Human HG10092-M
AKT1S1/PRAS40 cDNA ORF Clone, Human, untagged HG10092-UT
AKT1S1/PRAS40 cDNA ORF Clone, Human, C-GFPSpark® tag HG10092-ACG
AKT1S1/PRAS40 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10092-ACGLN
AKT1S1/PRAS40 cDNA ORF Clone, Human, N-GFPSpark® tag HG10092-ANG
AKT1S1/PRAS40 cDNA ORF Clone, Human, C-OFPSpark® tag HG10092-ACR
AKT1S1/PRAS40 cDNA ORF Clone, Human, N-OFPSpark® tag HG10092-ANR
AKT1S1/PRAS40 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10092-CF
AKT1S1/PRAS40 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10092-NF
AKT1S1/PRAS40 cDNA ORF Clone, Human, C-His tag HG10092-CH
AKT1S1/PRAS40 cDNA ORF Clone, Human, C-HA tag HG10092-CY
AKT1S1/PRAS40 cDNA ORF Clone, Human, N-HA tag HG10092-NY
AKT1S1/PRAS40 cDNA ORF Clone, Human, C-Myc tag HG10092-CM
AKT1S1/PRAS40 cDNA ORF Clone, Human, N-Myc tag HG10092-NM
AKT1S1/PRAS40 qPCR Primer Pairs, Human HP100175
info info
添加购物车成功! 添加购物车失败!