After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 ALDH1A3/RALDH3 Gene ORF cDNA clone expression plasmid, C-Flag 태그

데이터시트리뷰관련제품프로토콜
Human ALDH1A3 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000693.2
cDNA 크기:1539bp
cDNA 설명:Full length Clone DNA of Homo sapiens aldehyde dehydrogenase 1 family, member A3 with C terminal Flag tag.
유전자 동의어:ALDH6, RALDH3, ALDH1A6, ALDH1A3
:Human
벡터:pCMV3-C-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1530 G/A and 1536 C/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Aldehyde dehydrogenase 1 family, member A3 (ALDH1A3), also known as Retinaldehyde dehydrogenase 3 (RALDH3), which belongs to the aldehyde dehydrogenase family. ALDH1A3 is a novel Cancer stem cell (CSC) marker with potential clinical prognostic applicability, and demonstrates a clear correlation between CSC prevalence and the development of metastatic breast cancer. The retinoic acid (RA) biosynthesis enzyme aldehyde dehydrogenase 1A3 (ALDH1A3) is a putative androgen-responsive gene in human prostate cancer epithelial (LNCaP) cells. The RA biosynthesis enzyme ALDH1A3 is androgen responsive and (ii) DHT up-regulation of ALDH1A3 can increase the oxidation of retinal to RA and indirectly affect RA bioactivity and metabolism.

참고자료
  • Marcato P, et al. (2011) Aldehyde dehydrogenase activity of breast cancer stem cells is primarily due to isoform ALDH1A3 and its expression is predictive of metastasis. Stem Cells. 29(1)32-45.
  • Trasino SE, et al. (2007) Androgen regulation of aldehyde dehydrogenase 1A3 (ALDH1A3) in the androgen-responsive human prostate cancer cell line LNCaP. Exp Biol Med (Maywood). 232(6): 762-71.
  • Size / Price
    Cat No: HG11636-CF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human AURKB ORF mammalian expression plasmid, C-Flag tag
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".